ID: 1099543629

View in Genome Browser
Species Human (GRCh38)
Location 12:83947842-83947864
Sequence ATGTTGTTCTTAGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099543625_1099543629 -8 Left 1099543625 12:83947827-83947849 CCTGGTGACATGAGGATGTTGTT No data
Right 1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG No data
1099543623_1099543629 0 Left 1099543623 12:83947819-83947841 CCATTGGTCCTGGTGACATGAGG No data
Right 1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099543629 Original CRISPR ATGTTGTTCTTAGGGGAAGA AGG Intergenic
No off target data available for this crispr