ID: 1099544184

View in Genome Browser
Species Human (GRCh38)
Location 12:83955891-83955913
Sequence CTCTGCAGGCTATACAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099544180_1099544184 26 Left 1099544180 12:83955842-83955864 CCTGCAACTTGGTAAATTTATAA No data
Right 1099544184 12:83955891-83955913 CTCTGCAGGCTATACAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099544184 Original CRISPR CTCTGCAGGCTATACAAGCA TGG Intergenic
No off target data available for this crispr