ID: 1099558923

View in Genome Browser
Species Human (GRCh38)
Location 12:84148551-84148573
Sequence CTAAGGTTGCACAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099558923_1099558929 20 Left 1099558923 12:84148551-84148573 CCTGCTGCCCTGTGCAACCTTAG No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558923_1099558932 28 Left 1099558923 12:84148551-84148573 CCTGCTGCCCTGTGCAACCTTAG No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099558923 Original CRISPR CTAAGGTTGCACAGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr