ID: 1099558929

View in Genome Browser
Species Human (GRCh38)
Location 12:84148594-84148616
Sequence AGCCACTCCAGCTCCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1653
Summary {0: 59, 1: 89, 2: 214, 3: 429, 4: 862}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099558922_1099558929 21 Left 1099558922 12:84148550-84148572 CCCTGCTGCCCTGTGCAACCTTA No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558924_1099558929 13 Left 1099558924 12:84148558-84148580 CCCTGTGCAACCTTAGAACACTG No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558920_1099558929 28 Left 1099558920 12:84148543-84148565 CCCAAGGCCCTGCTGCCCTGTGC No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558921_1099558929 27 Left 1099558921 12:84148544-84148566 CCAAGGCCCTGCTGCCCTGTGCA No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558923_1099558929 20 Left 1099558923 12:84148551-84148573 CCTGCTGCCCTGTGCAACCTTAG No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558926_1099558929 3 Left 1099558926 12:84148568-84148590 CCTTAGAACACTGCTCCCAGCAT No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862
1099558925_1099558929 12 Left 1099558925 12:84148559-84148581 CCTGTGCAACCTTAGAACACTGC No data
Right 1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG 0: 59
1: 89
2: 214
3: 429
4: 862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099558929 Original CRISPR AGCCACTCCAGCTCCAGCTG TGG Intergenic
900724544 1:4207364-4207386 AGCCTCTCCTGCTGCTGCTGAGG - Intergenic
900738339 1:4314399-4314421 AACCACTCCAGCTTCAGCTGTGG - Intergenic
900903030 1:5529907-5529929 AGATACTCCAGCTCCAGCTATGG + Intergenic
900906444 1:5562922-5562944 AGCCACTACAGCACCAGCCATGG - Intergenic
901925451 1:12563365-12563387 AGCTGCTCTAGCTCCAGCTGTGG + Intergenic
902085320 1:13855820-13855842 AGCCACTCTGGCTCCAGCCAAGG + Intergenic
902526320 1:17060066-17060088 AGCCACCCCCACTCCAGATGGGG + Intergenic
902540681 1:17152378-17152400 TGCTGCTCCAGCTCCAGCTGTGG + Intergenic
902807754 1:18871655-18871677 GGCCACACCAGCTCCGGGTGGGG + Exonic
903187255 1:21635622-21635644 AGCAACCCCAGCCCCAGCTAGGG - Intronic
903450439 1:23450110-23450132 AGCATCTCCAGCCCCAGCTGTGG - Intronic
904068498 1:27773616-27773638 AGCAGCTCAAGCTTCAGCTGGGG - Intronic
904099592 1:28013227-28013249 TGCTACCCCAGCTCCAGCTTTGG - Exonic
904279013 1:29405373-29405395 AGTCACTCCAGCTCCCGCTGTGG + Intergenic
904292418 1:29496777-29496799 AGCCACTCCTCCTCCTGCAGGGG + Intergenic
904410870 1:30324120-30324142 AGCCACCTCAGCTCCCGGTGAGG - Intergenic
904465759 1:30706714-30706736 TGACACTCCAGCACCCGCTGTGG - Intergenic
904624994 1:31797592-31797614 AGGCACTCCAGCCCCTGCTCTGG - Intronic
905808490 1:40894297-40894319 AGCCACTGGAGATCCAGCTGTGG - Intergenic
906017041 1:42591386-42591408 AGCTACTACAGCTCCAGCTGTGG + Intronic
906353757 1:45085199-45085221 AGCCACTCCAGCTCTGGCTGTGG - Intronic
906371555 1:45258286-45258308 AGCCACTCTAACTCTAGCTGTGG + Intronic
906664355 1:47608615-47608637 AGCAGCTCCAGCTCCAGCCATGG - Intergenic
906894662 1:49758065-49758087 AGCTGCTTCAGTTCCAGCTGTGG + Intronic
907259330 1:53205748-53205770 AGGCACTCCAGCTCCAGCCATGG + Intronic
907586229 1:55620447-55620469 AGCTGATTCAGCTCCAGCTGTGG + Intergenic
907808138 1:57841657-57841679 AGCCACTCCAGCTCCAGCTGTGG - Intronic
908032879 1:60020229-60020251 AGTTGCTCCAGCTCCAGCTGTGG + Intronic
908062970 1:60371914-60371936 AGCCACTCTAGATCAAGCCGTGG + Intergenic
908093140 1:60707365-60707387 AACCAGTCCAGTCCCAGCTGTGG + Intergenic
908210509 1:61895459-61895481 AGGTGTTCCAGCTCCAGCTGTGG + Intronic
908407770 1:63831519-63831541 AGCCACTCCAGTTCCAGCCATGG - Intronic
908487686 1:64611075-64611097 AGCCACTCCAGCTCCAGCCATGG - Intronic
908601546 1:65744988-65745010 AGCAGCTCCAGCTTCAGCAGTGG + Intergenic
908620626 1:65975698-65975720 AGACACTCCAGCTCCAGCTGTGG + Intronic
908932307 1:69331711-69331733 AGCTGCTCCAGCTCCAGCCGCGG - Intergenic
909083682 1:71146808-71146830 AGCTGCTTCAGCTACAGCTGTGG + Intergenic
909124179 1:71644200-71644222 AGCCACACCAGCTTCACCTGTGG + Intronic
909133426 1:71767847-71767869 AGCAACTCCAGCTCCAGACATGG + Intronic
909235951 1:73152834-73152856 AGCGGCTTCAGCTCCAGCTGTGG - Intergenic
909257949 1:73448314-73448336 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
909368996 1:74862143-74862165 AGCCACTGTAGCTCCAGCCATGG - Intergenic
909532095 1:76692912-76692934 AGTCACTCCTGCTCCAGCCATGG - Intergenic
909867055 1:80686465-80686487 AGCCACTCCAGTTCCAGCTATGG - Intergenic
910414360 1:86982136-86982158 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
910460627 1:87444731-87444753 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
910513723 1:88036006-88036028 AGCAGCTCCAGCTCCAGCAATGG + Intergenic
910563576 1:88618693-88618715 AGCAGTTCCAGCTCCAGCTGTGG - Intergenic
910726913 1:90349383-90349405 AGCCACTTCAGCTCCAATTGTGG + Intergenic
911082832 1:93950242-93950264 AGCCACTTCAGCTCCAGCCATGG - Intergenic
911263540 1:95716239-95716261 AGACACACCAGCTGCAGATGAGG - Intergenic
911277507 1:95879696-95879718 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
911302533 1:96192707-96192729 AGCTGCTCTAGCTCCAGTTGTGG + Intergenic
911667059 1:100565233-100565255 AGCGGCTCCAGCTGCAGCTGTGG + Intergenic
911817167 1:102368227-102368249 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
911879977 1:103224808-103224830 AGCCACTCTGGCTCCAGCAGGGG + Intergenic
911982469 1:104583803-104583825 AACCACTTTAGCTCCATCTGTGG - Intergenic
912017605 1:105061002-105061024 AGCCATTCTAGCTCCAGTTGTGG - Intergenic
912084008 1:105976793-105976815 AGCTGCTTCAGCTCTAGCTGTGG + Intergenic
912086630 1:106014200-106014222 AGCCACTCCAGCTCTAGTTGTGG - Intergenic
912192167 1:107352900-107352922 GGCTGCTCCAGCTCCAGTTGTGG - Intronic
912735907 1:112149441-112149463 AGCCACTCCAGCTCCAGCCATGG + Intergenic
912809499 1:112783190-112783212 AGCCACTCCAGCTCCAATCTTGG - Intergenic
913018534 1:114763996-114764018 AGCTACTTCAACTCCAGCTGTGG + Intergenic
913039932 1:115012325-115012347 AGCCATTCCAGCTCCAGCCATGG + Intergenic
913051489 1:115120360-115120382 AGCTGCTCCAACTCCAGCTGTGG - Intergenic
914858637 1:151369648-151369670 AGTCCCTCCACCCCCAGCTGTGG + Intronic
915229227 1:154433265-154433287 AACCACTCACCCTCCAGCTGGGG - Intronic
915694164 1:157722126-157722148 AGCCACTCCATCTTCAGCCATGG - Intergenic
915946733 1:160158191-160158213 AGACCATCCAGCCCCAGCTGAGG - Intronic
916216408 1:162398949-162398971 ATCCTCTCCATCTCAAGCTGGGG + Exonic
916216531 1:162399916-162399938 ATCCTCTCCATCTCAAGCTGGGG + Intronic
916384824 1:164255587-164255609 AGCCACTCCAGCTCCAGTCATGG + Intergenic
916736032 1:167607797-167607819 AGCCACTCTGGCTCCAGTTGTGG + Intergenic
916829226 1:168474313-168474335 AGCCACTCTAGCTCCAGCTGTGG + Intergenic
916849031 1:168684029-168684051 AGCCACCCTGGCTCCAGCAGGGG + Intergenic
916910522 1:169341216-169341238 AGTCACTCCAGCTCAAGCCGAGG + Intronic
916982507 1:170154041-170154063 TCCCACTCCAGCTCTAGCTGTGG + Intronic
916987509 1:170207505-170207527 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
917002511 1:170375187-170375209 GGCCACTCCAGCTCCAGCTGTGG - Intergenic
917205147 1:172563935-172563957 AGCTGCTCCAACTTCAGCTGTGG + Intronic
917228901 1:172814553-172814575 AGCTGCTTCAGCTCTAGCTGTGG - Intergenic
917894535 1:179474972-179474994 AGCCACTTCAGCTCCAGCTGTGG + Intronic
918167634 1:181965510-181965532 AGCTGTTTCAGCTCCAGCTGTGG - Intergenic
918323080 1:183383199-183383221 AGCCACTCTAGCTCCAGCCGTGG - Intronic
918485875 1:185027624-185027646 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
918668241 1:187178693-187178715 AGTTGCTCCAGCTCCAGCTGTGG - Intergenic
918757705 1:188358141-188358163 AGCCACTCCAGCTCCGGCTGTGG - Intergenic
918844741 1:189594883-189594905 AGCCACTCCAGCTCCAGCCATGG + Intergenic
918993600 1:191729222-191729244 AGCCACTCCACCCTTAGCTGTGG - Intergenic
919006789 1:191909087-191909109 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
919027937 1:192201689-192201711 AGCTGCTTCAGGTCCAGCTGTGG - Intergenic
919179249 1:194059749-194059771 AGCCTCTCCAACTCATGCTGTGG - Intergenic
919254646 1:195105435-195105457 AACCACTCCAGCTCTAGCCATGG - Intergenic
919371945 1:196739081-196739103 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
919388744 1:196954801-196954823 AGCTGCTCCAGCTCCAGCCGTGG - Intronic
919394064 1:197022869-197022891 AGTCACTCCAGCTCCAGCAGTGG + Intergenic
919536763 1:198797115-198797137 AGCCACTCCAGCTCCAGTCATGG - Intergenic
920324958 1:205155930-205155952 AGCTGCTTCAGTTCCAGCTGTGG + Intronic
920533034 1:206718488-206718510 TGCCACTGCAGCTCCAGCCTGGG + Intronic
920594546 1:207255738-207255760 AACTTCTTCAGCTCCAGCTGTGG - Intergenic
920741248 1:208583106-208583128 AGTCATTCCAACACCAGCTGGGG - Intergenic
920785329 1:209035290-209035312 AGCCACTCCAGCCCCAGCTGTGG - Intergenic
921128014 1:212195385-212195407 GGCCACTCCAGCTCCTGCCGTGG + Intergenic
921457527 1:215389855-215389877 AGCCACTCCAGTTCCAGATGTGG - Intergenic
921465109 1:215477747-215477769 AGCTGCTCCAGCATCAGCTGTGG - Intergenic
921621450 1:217330280-217330302 AGTTGCTCCAGCTCCAGCCGTGG - Intergenic
921758360 1:218884091-218884113 AGCCACTCCAGCTCCAGCCATGG - Intergenic
922460682 1:225812471-225812493 AGTCACTCCACCTCCTGCAGTGG - Intronic
923139851 1:231151894-231151916 TGCCACTCCAGCTCCATCCAGGG - Intergenic
923172422 1:231429877-231429899 AAGTGCTCCAGCTCCAGCTGTGG - Intergenic
923423823 1:233848089-233848111 AGCCTCTCCAGCTCAAGATCTGG - Intergenic
923890958 1:238214534-238214556 AGCTGCTCCACCTCCAGCCGTGG - Intergenic
924316633 1:242804393-242804415 TGCCACTGCAACTCCAGCTTGGG - Intergenic
924616298 1:245614541-245614563 AGGAACTCCAGCCCCAGCTGTGG - Intronic
924729136 1:246696179-246696201 AGCCTCTCCAGCTCCACTTGGGG + Intergenic
924759257 1:246968838-246968860 AGCTGCTCCAGCTCCAGCCATGG - Intronic
924936587 1:248777251-248777273 AGCCACTCCAGCTCCATCCATGG + Intergenic
924948698 1:248863480-248863502 AGCTACTGCGGCTCAAGCTGTGG + Intergenic
1062770512 10:96624-96646 AGCCACTCCAGTTCCAGCTGTGG - Intergenic
1062771639 10:105490-105512 AGCCACTCTAGTCACAGCTGTGG - Intergenic
1062899398 10:1130946-1130968 AGCCACGTCAGATCCATCTGAGG - Exonic
1063124853 10:3128888-3128910 AGCCACCCCAGGTCCTCCTGGGG - Intronic
1063310204 10:4945170-4945192 AGCCACTTCAGCCCCAGCCATGG + Intronic
1063317098 10:5016978-5017000 AGCCACTTCAGCCCCAGCCATGG - Intronic
1063552044 10:7042583-7042605 AGGCAGTCCAGCTTCAGCTGAGG - Intergenic
1064340869 10:14484115-14484137 ATCCACCCCACCTGCAGCTGGGG - Intergenic
1064584171 10:16822990-16823012 GGTCACTCCAGCTCCAGCTACGG + Intergenic
1064626490 10:17266745-17266767 AGCTGTGCCAGCTCCAGCTGTGG + Intergenic
1064628147 10:17282578-17282600 AGCTGTGCCAGCTCCAGCTGTGG + Intergenic
1064902715 10:20312140-20312162 AGCCATTCCAGCTCTAGCTGTGG - Intergenic
1065732375 10:28721401-28721423 AGCAACTGCAGCTCTAACTGTGG - Intergenic
1065806229 10:29395615-29395637 AGGCACACCAGCTGCTGCTGTGG - Intergenic
1066040972 10:31547831-31547853 AGCCACTCCAGCTCCAGCCTTGG + Intergenic
1066058576 10:31703179-31703201 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1066083470 10:31955075-31955097 AGCTGCTCCATCTCCAGCTGTGG + Intergenic
1066996654 10:42570415-42570437 GGCAACTCCAGATCCAGCTGTGG + Intergenic
1067080704 10:43210810-43210832 CTCCACCCCAGGTCCAGCTGGGG + Intronic
1067652777 10:48168596-48168618 TGCCATTCCTGCTCCAGCTCAGG + Exonic
1067777108 10:49171724-49171746 AGCCACCCCAGCTCCTGGGGAGG + Intronic
1068046131 10:51888679-51888701 TCCCACTGCAGCTCTAGCTGTGG + Intronic
1068198077 10:53744798-53744820 AGCCACTCTAGCTCCAGCTGTGG - Intergenic
1068235773 10:54231230-54231252 AGCCATTCCAGCTCTAGCCATGG + Intronic
1068244137 10:54342317-54342339 TGCCACTCTAGCTCCAGCCATGG + Intronic
1068285079 10:54923188-54923210 AGCCAATCCAGCTCCAGCCATGG - Intronic
1068305235 10:55199763-55199785 AGCTGCTCTAGCTCCAGCCGTGG + Intronic
1068355846 10:55907405-55907427 AGCTTCTCCAGGTCCACCTGTGG - Intergenic
1068374772 10:56164665-56164687 AGCCATTCTATCTCCAGCTGTGG + Intergenic
1068404381 10:56570690-56570712 AGCCCCTCCACCTCCAGCTGTGG - Intergenic
1068418895 10:56763233-56763255 AGGCACTCCTGGCCCAGCTGTGG + Intergenic
1068434588 10:56973893-56973915 AGCCACTTCAGCTCCAACTATGG - Intergenic
1068495082 10:57776797-57776819 AACTATTTCAGCTCCAGCTGTGG - Intergenic
1069694140 10:70374390-70374412 CGCCACTGCACCTCCAGCTTGGG - Intronic
1069856084 10:71441900-71441922 TTCCACTCCCGCTCCAGCTAAGG + Intronic
1069991784 10:72320766-72320788 GGCCACACCAGCTACACCTGTGG + Intergenic
1070245835 10:74730582-74730604 GGCCACTCCAGCTCCAGCATTGG + Intergenic
1070349965 10:75582465-75582487 AGCCACTCCAGCTCCAGTCATGG - Intronic
1070581593 10:77724620-77724642 AGCTGCTCCAGCTCCAACTGTGG + Intergenic
1071059048 10:81548423-81548445 AGCCTCTCTGGCTCCAGCAGGGG - Intergenic
1071119073 10:82257050-82257072 AGCGACTTCAGCTCCAATTGTGG + Intronic
1071506952 10:86238341-86238363 AGGCACTCCAGCTCCAGCCATGG + Intronic
1071990153 10:91093519-91093541 AGCTGCTCCAGCTCCAGATGTGG - Intergenic
1072358210 10:94633222-94633244 GGTGACTCCAGCTCCAGCTGTGG + Intergenic
1073396690 10:103223855-103223877 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1073447431 10:103589930-103589952 ACCCACTCCAACCCCAGATGAGG - Intronic
1073461358 10:103667621-103667643 AGCCCCTACTGCTGCAGCTGTGG - Intronic
1073701716 10:105934940-105934962 AGCCACTTCAGCTCCAGCGTTGG + Intergenic
1073810992 10:107152069-107152091 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
1073929234 10:108555351-108555373 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1074657948 10:115616664-115616686 AGTCACTCCAGCTCCAGCCAAGG + Intronic
1075217791 10:120553770-120553792 GGCCACTCCAGCTCCAGCCATGG - Intronic
1075231690 10:120685322-120685344 AGACCCTCCCGCTCCTGCTGTGG - Intergenic
1076086245 10:127634614-127634636 AGCTGCTCCAACTCCAGCCGTGG - Intergenic
1076155505 10:128202087-128202109 AGCTGCTCCAGCTCCAGCCCTGG + Intergenic
1077372042 11:2186937-2186959 AGCCACTGCAACCCCCGCTGAGG + Intergenic
1077379065 11:2219790-2219812 AGCCACCCCAGATCCAGCCATGG - Intergenic
1077663860 11:4091612-4091634 AGACACACCATCTCCAGTTGGGG + Exonic
1077768620 11:5190324-5190346 GGCTGCTCCAGCACCAGCTGTGG + Intergenic
1078407874 11:11087018-11087040 ACCTACTCCACCTCCTGCTGAGG - Intergenic
1078516028 11:12023277-12023299 AGCTACTTCAGCTCCAGTAGTGG + Intergenic
1078698596 11:13659701-13659723 AGTCACTCCAGCTCCAGCTGTGG + Intergenic
1078750219 11:14154460-14154482 AGCCTCTCTAGCTCCAGCCATGG - Intronic
1078793472 11:14568885-14568907 AGCTGCTTCAGCTCCAGTTGTGG - Intronic
1078794068 11:14574328-14574350 AGCCACTCCAGCTCCAGATGTGG + Intronic
1078827002 11:14939035-14939057 AGCTACTCCAGCTCCAGCCATGG - Intronic
1078909330 11:15716644-15716666 AGCAACATCAGCCCCAGCTGTGG - Intergenic
1079465293 11:20723990-20724012 AGCTGCTCCAGCTCCAGCAGTGG - Intronic
1079707401 11:23637814-23637836 AGCCACTCTATCTCCAGCCGTGG - Intergenic
1079713661 11:23718017-23718039 AGCCACTCCAGCTCCTTTTGTGG + Intergenic
1079744391 11:24106800-24106822 AGATGCTTCAGCTCCAGCTGTGG + Intergenic
1079925126 11:26484352-26484374 AGCCACCACAGCTCCAGCAGTGG + Intronic
1079952701 11:26824077-26824099 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1080136230 11:28857811-28857833 AGCCACTCCAGCTCCAGCCTTGG - Intergenic
1080164903 11:29224800-29224822 AGCCTCTTTGGCTCCAGCTGGGG + Intergenic
1080192774 11:29571209-29571231 GGCTACTCCAGCTCCTGCTATGG - Intergenic
1080613763 11:33927993-33928015 AGACACTCCAGTTCCTGCTTTGG - Intergenic
1080946336 11:36979148-36979170 AGCTGTTCCAGCTCCAGCAGTGG - Intergenic
1080946757 11:36982232-36982254 TGCCACTCCAGCTCTAGCTGTGG - Intergenic
1081051797 11:38350400-38350422 AGATACTGCAGCTCCAGCTGTGG - Intergenic
1081181648 11:39991986-39992008 GGCCACTCCAACTCCAGCTAGGG + Intergenic
1081261859 11:40971323-40971345 AGCCACTCCAGCTCCAGCCATGG + Intronic
1081270549 11:41077528-41077550 AGCCACTCCAGCTCCAGCCATGG - Intronic
1081325450 11:41738577-41738599 AGCTATTCCAGCTTCAGCTGTGG - Intergenic
1081364000 11:42213244-42213266 GGCTACTCCAGCTCCAGAGGGGG + Intergenic
1081521470 11:43885955-43885977 ATCCAATCCACCTCCAGCTTTGG - Intronic
1082119031 11:48358005-48358027 AGCCACTCCAGCTCTAGTCATGG - Intergenic
1082139875 11:48596169-48596191 AGCCACTTCAGATCCAGCTGTGG - Intergenic
1082616872 11:55371560-55371582 AGCCACTCCAGGTCTAGCTGTGG - Intergenic
1083136129 11:60678331-60678353 AGCCACACCAGCTCCAGCTGTGG - Intergenic
1083632973 11:64105201-64105223 AGCCAGCCCAGCTCCGGCTCAGG - Intronic
1083792240 11:64993489-64993511 AGCCAATTCAGTTCCAGATGAGG - Intronic
1084498697 11:69521495-69521517 GGCTGCTCCAGCTCTAGCTGGGG - Intergenic
1084838690 11:71827328-71827350 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1084881956 11:72177825-72177847 AGCAACTACAACTACAGCTGAGG + Intergenic
1085000314 11:73027812-73027834 AGCTGCTCCAGCTCCAGCCGTGG + Intronic
1085452025 11:76639902-76639924 TGCCACATCAGCTGCAGCTGGGG - Intergenic
1085600887 11:77855061-77855083 GGCCACTCCAGCTCTAGCTATGG - Intronic
1085653101 11:78286350-78286372 AGCACCTCCAGCTCTACCTGGGG - Intronic
1085818824 11:79770625-79770647 AGCCACTCCAACTCCAGTTATGG + Intergenic
1085965029 11:81513159-81513181 AGCCACCCCTGCTTCAGCTGTGG + Intergenic
1085981417 11:81730851-81730873 AGTCACTCCAGCTCCAGCCATGG + Intergenic
1086085196 11:82946088-82946110 AGCCACCCAAACTGCAGCTGTGG - Intronic
1086564723 11:88212381-88212403 TGCTGCTCCAGTTCCAGCTGTGG - Intergenic
1086601794 11:88642233-88642255 GGCCACTCAAGCTCTAGCTGTGG - Intronic
1086669708 11:89531875-89531897 AGGCACTCCAGCTCCAACCATGG + Intergenic
1086729322 11:90228156-90228178 AGCCACTCCAGTTCCAGCTATGG - Intergenic
1086954833 11:92925326-92925348 AGCCACCCTAGCTCCAGTTATGG + Intergenic
1087171473 11:95053807-95053829 AGTTGCTCCAGCTCTAGCTGTGG + Intergenic
1087437895 11:98145583-98145605 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1087474342 11:98618155-98618177 AGACACTTCAGCTCCAGCTGTGG - Intergenic
1087480404 11:98693181-98693203 AGCCACTCCAGATCCAGCTGTGG + Intergenic
1087480781 11:98698136-98698158 AGCCACTGTAGCTCCAGTGGTGG - Intergenic
1087675601 11:101158103-101158125 AACTGCTTCAGCTCCAGCTGTGG + Intergenic
1087708385 11:101521270-101521292 AGCCACTCCAGCTCCAGCTGCGG + Intronic
1087781183 11:102302817-102302839 GGCCACTCCAGCTCCACCCATGG - Intergenic
1087807313 11:102568994-102569016 AGCTACTTCAGCTCCAGCTGTGG - Intergenic
1088388832 11:109290882-109290904 AGCTACTCCAGCTCCAGCTGTGG - Intergenic
1088704400 11:112448353-112448375 GGCCACCCAAGCTGCAGCTGTGG - Intergenic
1088953865 11:114598674-114598696 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1089663133 11:119998716-119998738 GGCCTCTCCAGCTCCAGATGGGG + Intergenic
1089669532 11:120043946-120043968 AGCCACTGTAGCTACAGCTGTGG - Intergenic
1089686970 11:120157460-120157482 TGCCACTGCAGCACCATCTGAGG - Intronic
1089746156 11:120618666-120618688 CCACACTCCAGCTCCAGCCGAGG + Intronic
1089865474 11:121627713-121627735 AGCCACTACAGCTCCAGGCTGGG + Exonic
1089951919 11:122536002-122536024 GGCCAGTCCAACTCCAGCTGTGG + Intergenic
1090179646 11:124685236-124685258 AGCTGCTTCAGCTCCAGCTCTGG + Intronic
1090490891 11:127159695-127159717 AGCCACTCTACCTCCAGCAGTGG - Intergenic
1090514756 11:127412776-127412798 AGCCACTCAAACCACAGCTGTGG - Intergenic
1090756367 11:129795198-129795220 AGCCACTCCAGCTCCAGCCTTGG - Intergenic
1090758947 11:129818594-129818616 AACCACTCCAGAGGCAGCTGTGG - Intronic
1090842755 11:130507225-130507247 AGCTGCTCCAGCTCTAGCTGTGG + Intergenic
1091146160 11:133282307-133282329 GGCTGCTCCAGCTCCAGCTGTGG + Intronic
1091485682 12:885456-885478 AGACACTCCTGCTCCAGGAGAGG - Exonic
1091552870 12:1550154-1550176 GGCTGCTCCAGCTCCAGCTGTGG + Intronic
1091974011 12:4810502-4810524 AGCCCTTCCAGCGCCAGGTGTGG + Exonic
1092001093 12:5032994-5033016 AGCCACGCCAGCCCCAGCCCCGG + Intergenic
1092204160 12:6605724-6605746 AAGCACTCCAGATCCTGCTGAGG + Intronic
1092399989 12:8166761-8166783 AGCCACTCCAGCTCCAGCCATGG - Intronic
1092441598 12:8509424-8509446 AGCCACTCCACCCCCGCCTGAGG - Intergenic
1092531938 12:9352148-9352170 AGCCTCTCCTTCTACAGCTGTGG + Intergenic
1092670521 12:10856042-10856064 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
1092853104 12:12648386-12648408 AACCACTCCACCTCCAGCTATGG - Intergenic
1093038119 12:14352169-14352191 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1093426348 12:19032931-19032953 AGTTGCTCCAGTTCCAGCTGTGG - Intergenic
1093478743 12:19583353-19583375 AGCTACTCCAGCTCCAGCCATGG + Intronic
1093493185 12:19726877-19726899 AGCCACCCAAGCTGCAGCTGTGG - Intergenic
1094002191 12:25707310-25707332 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1094036994 12:26082155-26082177 AGCCACTGCAGCTCCAGCTGCGG - Intergenic
1094251745 12:28369871-28369893 AGCTACTCCAGCTCTAGCTGTGG - Intronic
1094288213 12:28817616-28817638 TGCCCTTCCAGCACCAGCTGTGG + Intergenic
1094777325 12:33745748-33745770 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1095226743 12:39686460-39686482 AGTCACTCCAGCTCCAGCCATGG - Intronic
1095395416 12:41757080-41757102 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1095413210 12:41946512-41946534 AGCCATTCCAGTTCCAGCTATGG - Intergenic
1095516838 12:43015635-43015657 GGCCACTTCAGCTCCAGCCATGG + Intergenic
1095731578 12:45511693-45511715 AGCTGCTCCAGCTCCAGCCGTGG - Intergenic
1095782728 12:46078153-46078175 AGCTCCTCCAGCTCCAGCTTTGG - Intergenic
1095842947 12:46714411-46714433 AGCCACTCCAACTCTAGCCTTGG - Intergenic
1095873021 12:47051120-47051142 AGCTGCTCCAGCTCCAGCTATGG - Intergenic
1095919756 12:47517230-47517252 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1095933121 12:47649177-47649199 AGCCTCTCCAGCCCCAACTAAGG + Intergenic
1095978674 12:47957656-47957678 AGCCGCTCCAGCTCCAGCTGTGG + Intergenic
1096050890 12:48606466-48606488 AGCCACTCCAGCTCCAGTTATGG - Intergenic
1096566073 12:52480340-52480362 AACTGCTTCAGCTCCAGCTGTGG + Intergenic
1096886907 12:54727207-54727229 AGCTGCTCTAGCTCCAGCTATGG - Intergenic
1096959881 12:55567659-55567681 AGCCACTGTAGCTCCAGCCATGG + Intergenic
1097136852 12:56864314-56864336 AGCTGCTCCAGCTCCAGCTATGG + Intergenic
1097302779 12:58035936-58035958 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1097343646 12:58467327-58467349 AGCCACTCCAGCTTCAGCTGTGG - Intergenic
1097486709 12:60212597-60212619 AGCTGCTCCAGCTCCAGCCGTGG + Intergenic
1097492672 12:60290532-60290554 AGCCACTCTAGCTCCAGCTGTGG + Intergenic
1097513074 12:60567863-60567885 AGCCACTCCAGCTCCAGTTGTGG + Intergenic
1097554042 12:61115416-61115438 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1097588354 12:61542264-61542286 AGAGACTTCAGCTCCAGATGAGG - Intergenic
1097633894 12:62098414-62098436 AGCCACTGCAGCCCAAGCTTAGG - Intronic
1097866562 12:64563989-64564011 ACCCACTCCATGCCCAGCTGGGG - Intergenic
1098610704 12:72453774-72453796 AGCTGCTCCATTTCCAGCTGTGG + Intronic
1098713660 12:73801276-73801298 AGCTGCTTCAGCTCTAGCTGTGG + Intergenic
1098771616 12:74559833-74559855 AGCCATTCCAGCTCCAGCCATGG - Intergenic
1098836350 12:75428760-75428782 AGCCATTCCAGCTTAAGCTGTGG + Intronic
1098939567 12:76518781-76518803 AGCTGCTCCAGCTCCAGCCTCGG - Intronic
1099229325 12:80003823-80003845 AGCCATGCCAGCTCCAGCCATGG - Intergenic
1099390179 12:82070043-82070065 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1099525306 12:83711226-83711248 GGCCACTCCAGCTTCAGCCATGG - Intergenic
1099536801 12:83855590-83855612 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1099558929 12:84148594-84148616 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1099568166 12:84278924-84278946 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1099587127 12:84533021-84533043 AGCTGCTCCAGCTCCAGTTGTGG + Intergenic
1099627180 12:85090045-85090067 GGCTGCTCTAGCTCCAGCTGTGG + Intronic
1099760276 12:86912264-86912286 AGCGACTCTAGCTCCAGCCATGG + Intergenic
1099796669 12:87409153-87409175 AGCTGCTCCAGCTCCAGCCTAGG + Intergenic
1100028859 12:90161982-90162004 AGCCACTACAGCTCCAGCCATGG - Intergenic
1100032369 12:90209027-90209049 AGCTGCTTCAGCTCTAGCTGGGG + Intergenic
1100038438 12:90281742-90281764 AGCTGCTTCAGATCCAGCTGTGG + Intergenic
1100072246 12:90735109-90735131 AGCCACTCCAGCTGCAGTTGTGG - Intergenic
1100123399 12:91395092-91395114 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1100170623 12:91970900-91970922 AGTCACTCCAGCTCCAGTTGTGG - Intergenic
1100230352 12:92600438-92600460 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1100597903 12:96087551-96087573 AGCCACTCCAGCTCCAGCAGTGG + Intergenic
1101052059 12:100873960-100873982 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
1101674819 12:106908138-106908160 ATCCACCCCAGCCTCAGCTGAGG + Intergenic
1101764117 12:107682690-107682712 AGCCACCCAAACTGCAGCTGTGG - Intergenic
1102301527 12:111774979-111775001 CGCCATTCCAGCAACAGCTGTGG - Intronic
1102391747 12:112554703-112554725 AGCGACTTCAGCTTCAACTGTGG - Intergenic
1103223574 12:119267278-119267300 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1103358173 12:120337122-120337144 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1104030840 12:125065192-125065214 ACGCCCTCCAGCTCCAGGTGAGG + Intergenic
1104037400 12:125107167-125107189 AGCTGCTCGAACTCCAGCTGCGG - Exonic
1104677993 12:130728888-130728910 AGCCACAGCAGCTCCCACTGAGG + Intergenic
1105577194 13:21664899-21664921 ACCGATACCAGCTCCAGCTGTGG + Intergenic
1105968563 13:25406474-25406496 AGCAACTCCACCTCCACCTTGGG - Intronic
1106119459 13:26847437-26847459 AGCCCCTCCCCCTCCAGCAGAGG - Intergenic
1106130547 13:26935975-26935997 GGCCACTCTGGTTCCAGCTGTGG + Intergenic
1106843137 13:33708112-33708134 GGCCACTTCTGCTGCAGCTGGGG - Intergenic
1106864415 13:33948205-33948227 AGCTGCTTCAGCTCTAGCTGTGG + Intronic
1106960345 13:34990493-34990515 AGCTTCTCCAGCTCCAGCTGTGG - Intronic
1107061065 13:36160380-36160402 AGCCTCTCCACTTCCAGCTTGGG - Intergenic
1107105377 13:36637119-36637141 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1107330684 13:39296466-39296488 AGCTGCTCCAGCTCCAGTGGTGG + Intergenic
1107362683 13:39637255-39637277 CGCCACTGCAGCTCCAGCCTGGG - Intergenic
1107549683 13:41463299-41463321 AGCCAAACCTGCTGCAGCTGAGG - Intronic
1108118696 13:47160176-47160198 AGCCACCCAAGCTGCAGCTGTGG + Intergenic
1108277567 13:48826511-48826533 AGCCACCTCAGCTCCAGCTGTGG - Intergenic
1108768366 13:53663417-53663439 AGCTGCTCCAGCTCCAGCCTTGG + Intergenic
1108770948 13:53699941-53699963 AGCCATCCCAGCTCCAGCCATGG + Intergenic
1108828939 13:54452858-54452880 AGCTGCTTCAGCTCCAACTGTGG - Intergenic
1108883959 13:55156580-55156602 AGCCACTCCAGTTCCAACTGTGG + Intergenic
1108885654 13:55178316-55178338 AGCTGCTTTAGCTCCAGCTGTGG + Intergenic
1108893574 13:55294574-55294596 AGCTACTCTGGCTCCAGCTTTGG + Intergenic
1108930134 13:55807485-55807507 AGCTGCTCCAGCTCCAGCCGTGG - Intergenic
1108956690 13:56166954-56166976 AGCCGCTCCAGGTCCAGCTGAGG - Intergenic
1109003358 13:56835565-56835587 TGCCATTCCAGCTCCAGCCATGG - Intergenic
1109189556 13:59308252-59308274 AGCTGCTTCAGCTCCAGCAGTGG - Intergenic
1109297545 13:60552867-60552889 AGCCACCCCAGCTCCAGCCATGG - Intronic
1109426124 13:62168003-62168025 AGCCACCCAAACTGCAGCTGTGG + Intergenic
1109502504 13:63255902-63255924 AGACACTCTAGCTCCAGAAGTGG - Intergenic
1109524400 13:63556972-63556994 AGCCACTGCAGCTCCAGACATGG + Intergenic
1109616188 13:64837048-64837070 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1109857847 13:68156523-68156545 AGCCACTCCAGCTCCAGCTATGG - Intergenic
1109962099 13:69644696-69644718 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1110166366 13:72448088-72448110 AGCTGCTTCAGCTTCAGCTGTGG + Intergenic
1110411180 13:75205125-75205147 AGTCACTCCAGCACCAGCCATGG - Intergenic
1110900786 13:80821547-80821569 TACCACTCCAGCTCCAGCCTGGG - Intergenic
1111051213 13:82884681-82884703 AGCCACCCCAGCTCCAGCTGTGG - Intergenic
1111065729 13:83089132-83089154 AGTCACTCCAGCTTTAGCTGTGG + Intergenic
1111163131 13:84421264-84421286 TGCCACTCCAGCTCCAGCTGTGG + Intergenic
1111207280 13:85027484-85027506 AGCCATTACAGCTCCAGCAGTGG - Intergenic
1111207773 13:85035182-85035204 AGCCACTACAAATCCAGCTGTGG + Intergenic
1111219059 13:85180612-85180634 AGATGCTCCAGCTCCAGCTGTGG + Intergenic
1111221305 13:85208437-85208459 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1111227137 13:85288757-85288779 AGCCACCCCAGCTCCAGCAATGG - Intergenic
1111318040 13:86586484-86586506 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1111419826 13:87998313-87998335 AGTCACTCCAGCTCCAGCCATGG + Intergenic
1111568527 13:90047974-90047996 AGCCACTCCACCTCCAGCCATGG - Intergenic
1111584051 13:90261561-90261583 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1111641980 13:90980419-90980441 AGCCACTCCAGCTCTAGCCGTGG - Intergenic
1112055251 13:95684758-95684780 AGTTACTCCAGCTCCAGCCATGG + Intronic
1112451013 13:99509591-99509613 GGCCACTCCAGCTCCAGCCATGG - Intronic
1112568240 13:100569459-100569481 AGTTGCTGCAGCTCCAGCTGTGG - Intronic
1112742982 13:102495724-102495746 AGCCACTCCAGCTCTAGCTGTGG - Intergenic
1112790310 13:102995516-102995538 AGCCACCCCAGCTCCAGCCGTGG - Intergenic
1112881299 13:104109385-104109407 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1112929145 13:104713545-104713567 AGCTGCACCAGCTCCAGCTGTGG - Intergenic
1112954595 13:105042266-105042288 AACTACTCCAGCTCCAGTTGTGG - Intergenic
1113177940 13:107587879-107587901 AGACACTCCATCTCCATGTGTGG - Intronic
1113203109 13:107888319-107888341 AGCCACTCCATCTCCAGCTGTGG - Intergenic
1113252741 13:108472257-108472279 AGTCACTCCAACTCCAGCCATGG + Intergenic
1113496959 13:110738659-110738681 AGCCACTCCAGCTCCATCTGTGG + Intergenic
1113972457 13:114200319-114200341 AGCCGTTCCTCCTCCAGCTGGGG - Intergenic
1114147469 14:19994023-19994045 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1114941982 14:27623925-27623947 AGCTGTTTCAGCTCCAGCTGTGG - Intergenic
1115065714 14:29257196-29257218 ATCCACTGCAGCTCCAGCCATGG - Intergenic
1115277283 14:31622589-31622611 AGACACTCTAGCTCCAGCTGTGG + Intronic
1115916573 14:38321561-38321583 AGCCGCTCCAGTTCTAGCTGTGG - Intergenic
1115932158 14:38508938-38508960 AGCTGTTTCAGCTCCAGCTGTGG - Intergenic
1115936617 14:38559825-38559847 GGCCATTACAGCTCCAGCTTTGG - Intergenic
1115944400 14:38643668-38643690 ACCCACTCCAGCTCCAACCATGG + Intergenic
1116098925 14:40408542-40408564 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1116119712 14:40706423-40706445 AGCCACTCCAGCTAAAGCTGTGG - Intergenic
1116263535 14:42660729-42660751 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1116264761 14:42674166-42674188 AGCTGCTTCAGCTCTAGCTGTGG - Intergenic
1116485484 14:45443904-45443926 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1116526850 14:45916400-45916422 GGCTGCTCCAGCTCTAGCTGGGG - Intergenic
1116696376 14:48183224-48183246 AGCCACCCCAGCTCCAGCTATGG + Intergenic
1116998279 14:51346893-51346915 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1117241350 14:53837121-53837143 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1117632713 14:57710166-57710188 AGCTGCTTCAGCTCCAGCTATGG + Intronic
1117749213 14:58902988-58903010 AGCCGTTCCAGCTCCAGCCATGG + Intergenic
1117886715 14:60371790-60371812 AGCTGCTCCAGCTCCAGTTGTGG + Intergenic
1117907485 14:60605598-60605620 AGCTGCCTCAGCTCCAGCTGTGG + Intergenic
1117908251 14:60612158-60612180 AGCTGCCTCAGCTCCAGCTGTGG - Intergenic
1117977297 14:61310976-61310998 TGCTGCTTCAGCTCCAGCTGTGG - Intronic
1117984579 14:61374667-61374689 AGCCACTCCAGCTTCAACCATGG - Intronic
1118083329 14:62387295-62387317 AGGCACTCCAGCTCCAGCCATGG + Intergenic
1118536053 14:66765925-66765947 AGAGACTCCAGTTCCACCTGTGG + Intronic
1118956775 14:70489803-70489825 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1118957038 14:70491739-70491761 AGCCACTCCAGCCTTAGCAGTGG - Intergenic
1118963882 14:70561683-70561705 AGCCATTCCAGCTCCAGCCATGG + Intergenic
1119709218 14:76809283-76809305 ACCCCCTCCACCTCCAGCAGTGG + Exonic
1120377609 14:83729709-83729731 AGCCACTCAAGCTCCAGCTGTGG - Intergenic
1120413779 14:84193818-84193840 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1120570937 14:86116135-86116157 AGCTGCTCCAAATCCAGCTGTGG + Intergenic
1120583209 14:86279717-86279739 AGCTATTCCAGCTCCAACTGTGG + Intergenic
1120590937 14:86372659-86372681 AGCTGTTTCAGCTCCAGCTGTGG + Intergenic
1120654179 14:87169442-87169464 AGCCTTTCCAGCTCCAGCCATGG - Intergenic
1120661632 14:87257709-87257731 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1120693799 14:87621731-87621753 AGCCACTCTAGCTCCTGCCGTGG - Intergenic
1121082206 14:91117410-91117432 AGCCACTCCATCTCGAACAGGGG - Intronic
1121140752 14:91539501-91539523 GGCCACTCCAGCTCCAGCCATGG - Intergenic
1121237964 14:92406677-92406699 AGCAGCTCCAGCTCCAGCTGTGG - Intronic
1121318773 14:92978625-92978647 AGCTGCTCCAGCTCCAGCAGTGG + Intronic
1121369324 14:93342352-93342374 AGCCACTCCAGCTCCAGCCATGG - Intronic
1121384796 14:93510125-93510147 AGCCACTCCAGCTCCAGCTGTGG - Intronic
1122831872 14:104402143-104402165 AGCCACTCCAGCTTTAGCCATGG + Intergenic
1122840349 14:104459057-104459079 AGCCAGGCCATCTCCAGCGGGGG + Intergenic
1122863101 14:104591371-104591393 AGCCACCCCACCTTCTGCTGGGG + Intronic
1123128110 14:105964274-105964296 AGCTGCTCCAGGTCTAGCTGTGG + Intergenic
1123408634 15:20040430-20040452 AGCTGCTCCAGGTCTAGCTGTGG + Intergenic
1123517965 15:21047140-21047162 AGCTGCTCCAGGTCTAGCTGTGG + Intergenic
1123737583 15:23200287-23200309 AGCCACTCCAGCCATGGCTGGGG - Intergenic
1124288795 15:28428949-28428971 AGCCACTCCAGCCATGGCTGGGG - Intergenic
1124294430 15:28488364-28488386 AGCCACTCCAGCCATGGCTGGGG + Intergenic
1124632156 15:31344161-31344183 TGTCACTCCAGCTCCAGAGGTGG + Intronic
1124937436 15:34186389-34186411 AGCCACCCAAACTGCAGCTGTGG + Intronic
1125049225 15:35278242-35278264 GGCTGCTCCAGCTCCAGATGTGG + Intronic
1125230765 15:37452761-37452783 AGCCATGCCAGCTCCAGCCATGG + Intergenic
1125238990 15:37550850-37550872 AGCAACTACAGCTGCACCTGAGG + Intergenic
1125251779 15:37713313-37713335 GGCCACTCCAGCTCTAGCAATGG + Intergenic
1125407828 15:39371414-39371436 AGCCACTCCAACTCCAATTGTGG - Intergenic
1125718003 15:41830624-41830646 AGCCTCCCAAGCTGCAGCTGTGG + Intronic
1126203825 15:46019801-46019823 GGCAGCTCCAGCTCAAGCTGTGG + Intergenic
1126273100 15:46844998-46845020 AGCCACTCCAGCTCTAGCTATGG - Intergenic
1126929495 15:53632224-53632246 TGCTACTCCAGCACCAGTTGTGG + Intronic
1127110838 15:55667972-55667994 AGCCACTCAGGACCCAGCTGAGG + Intronic
1127137853 15:55943457-55943479 AGCCACTCCAGCTCCAGCTGTGG + Intronic
1127506048 15:59598962-59598984 TGCCACTGCACCTCCAGCTTGGG - Intronic
1127674858 15:61229052-61229074 AGCTATTCCAGCACCAGCAGAGG - Intronic
1128056740 15:64705141-64705163 AGACATTCCAGCTCCCTCTGAGG - Intergenic
1129692882 15:77723777-77723799 AACGACCCCAGCCCCAGCTGGGG + Intronic
1129693697 15:77728530-77728552 GGCAGCTCCAGCTCCAGCTTGGG + Intronic
1129715360 15:77845320-77845342 AGTCACTCCAGCTCCAGCTGTGG + Intergenic
1130030359 15:80308324-80308346 AGCCTCTCCAGAGCCAGCAGAGG + Intergenic
1130409352 15:83631641-83631663 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1130774958 15:86969220-86969242 AGCAAATTCTGCTCCAGCTGTGG + Intronic
1132003925 15:98208819-98208841 AGAAACTTCAGATCCAGCTGGGG - Intergenic
1132658429 16:1051089-1051111 AGCCACCCCTGCTCCAGCGACGG - Intergenic
1133043108 16:3071093-3071115 AGCCACTCCAGCTCCAGCTGTGG - Intronic
1133045193 16:3084048-3084070 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1134550328 16:15135902-15135924 AGCCGCGGCAGCACCAGCTGAGG + Intronic
1134640066 16:15823021-15823043 GCCCGCTCCAGCTCCAGCTCCGG - Intronic
1134718138 16:16367093-16367115 AGCCGCGGCAGCACCAGCTGAGG - Intergenic
1134956614 16:18385066-18385088 AGCCACGGCAGCACCAGCTGAGG + Intergenic
1136048143 16:27631672-27631694 GGCCACTCCAGCCCCACTTGGGG + Intronic
1136508955 16:30724110-30724132 ACCAAATCCAGCTCCAGCTCAGG + Exonic
1136510814 16:30737372-30737394 ACCCACTCCAGCTTCAGCTCCGG + Exonic
1137358689 16:47792210-47792232 AGCCACTCCAGCTGCAGCCATGG - Intergenic
1137638538 16:50008653-50008675 AGCTACTCCAGCTCCAGCCACGG + Intergenic
1138060852 16:53888826-53888848 AGCCACTCAAACTCGACCTGTGG - Exonic
1138352992 16:56356430-56356452 AGCCCCTGGAGCTCCTGCTGGGG + Intronic
1138548768 16:57735844-57735866 GCCCACTCCACCTGCAGCTGCGG - Exonic
1138800135 16:60016816-60016838 AGCCACTCCAGCTTTAGCCTTGG - Intergenic
1138902913 16:61296375-61296397 AGCCACTCCAGTTCCTGCCTGGG - Intergenic
1138997620 16:62474132-62474154 AGCTGCTTCAGCTCCAACTGTGG + Intergenic
1139596205 16:67959801-67959823 AGCTGCTCCAGCTCCAGCACCGG - Intronic
1142435565 16:90054807-90054829 TGCCACTCCAGCTTCAGCCATGG + Intergenic
1142631515 17:1229235-1229257 AGCTCCTGCAGCCCCAGCTGCGG - Intergenic
1142784879 17:2213374-2213396 AGCCTCCACAGCTCCATCTGTGG - Intronic
1142899185 17:3001915-3001937 CGCCACCCCACCTCCAGCTGTGG + Intronic
1142909926 17:3080099-3080121 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1142924578 17:3223710-3223732 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1142938764 17:3362945-3362967 AGCTGCTGCAGCTCCAGCTGTGG - Intergenic
1143033792 17:3982817-3982839 AGCCCCTTCAGGTCCAGCAGAGG + Intergenic
1144122217 17:12165996-12166018 TGCTGCTACAGCTCCAGCTGTGG - Intergenic
1144216257 17:13058097-13058119 AGATTCACCAGCTCCAGCTGTGG - Intergenic
1144324809 17:14168711-14168733 AGCCGTTCCAGCTCCAGCTGGGG - Intronic
1144952873 17:19003635-19003657 GGCCAGCCCAGGTCCAGCTGCGG + Exonic
1146523101 17:33541783-33541805 AGGTACTCCATCTCCAGGTGTGG + Intronic
1147190257 17:38734248-38734270 TGCCCCTCCACCCCCAGCTGAGG - Exonic
1147424469 17:40339429-40339451 AGGCCCCCCAGCCCCAGCTGCGG + Intronic
1147457549 17:40547626-40547648 AGCTGCTCCACCCCCAGCTGTGG - Intergenic
1147468604 17:40634243-40634265 AGCTACTCCAGCTGAGGCTGAGG - Intronic
1147754750 17:42761083-42761105 AGCGACTCCCCCTCCAGCCGCGG + Intronic
1147763767 17:42818955-42818977 AGACTCTCAAGCACCAGCTGAGG + Intronic
1148104684 17:45112969-45112991 AGACCCTGCAGTTCCAGCTGCGG - Exonic
1148345578 17:46901486-46901508 AGCCAATGCAGCTGGAGCTGGGG + Intergenic
1148657504 17:49298676-49298698 AGCCACCCCAGTTCCTTCTGTGG - Exonic
1148762616 17:50014815-50014837 GACTGCTCCAGCTCCAGCTGTGG - Intergenic
1148863272 17:50615538-50615560 GGCCCCCCCACCTCCAGCTGAGG + Intronic
1149028953 17:52062605-52062627 AGCTGCTCCAGCTCCAGGTGAGG + Intronic
1149072187 17:52556374-52556396 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1149113508 17:53063131-53063153 AGCTGCTCCAGCTCCAGAGGTGG + Intergenic
1149163940 17:53727134-53727156 AGCTGCTTCATCTCCAGCTGTGG - Intergenic
1149231867 17:54544385-54544407 AGTCTCCCCAGCTCCAGCAGGGG - Intergenic
1149339695 17:55672624-55672646 AGCTGCTTCAGTTCCAGCTGTGG - Intergenic
1150314099 17:64154486-64154508 ATGCACTCCAGCTGAAGCTGAGG + Intronic
1150350193 17:64438305-64438327 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1150950787 17:69801008-69801030 AGCCACCCAAGCCTCAGCTGCGG + Intergenic
1150963559 17:69940919-69940941 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1151041022 17:70861205-70861227 AGACACTCCAGCTACAGCCATGG + Intergenic
1151249781 17:72825216-72825238 AGCCACTCCAGTTCCAGGTATGG + Intronic
1151322934 17:73362335-73362357 CCCCACTCCAGCTCCACCTCTGG + Intronic
1151585244 17:75004671-75004693 GGACACTCCAGGCCCAGCTGAGG - Exonic
1151773221 17:76178392-76178414 AGACACGCCAGCTGCCGCTGTGG - Intronic
1151995149 17:77603666-77603688 AGCCACCCCAGACCCAGCAGAGG + Intergenic
1152321107 17:79609388-79609410 AGCGACTTCACCACCAGCTGGGG + Intergenic
1152718073 17:81909362-81909384 ACCCAGCCCAGCCCCAGCTGAGG - Intronic
1152762203 17:82114700-82114722 AGCCACTCCACCCCCAGGCGTGG + Intronic
1153107956 18:1549987-1550009 AGCATCCCCAGCTCCAGCTGTGG + Intergenic
1153392079 18:4573974-4573996 AGCCATTTCAGCACCAGCTGTGG + Intergenic
1153556881 18:6324027-6324049 AGCCACTCCAGCTCCAGCCATGG + Intronic
1153601031 18:6781518-6781540 AGCAGCTCCCGCTCCCGCTGGGG - Intronic
1153615595 18:6930116-6930138 AGGCACCCCAGCTCGGGCTGAGG + Intergenic
1155228725 18:23753116-23753138 AGCCAGCTCAGATCCAGCTGAGG - Intronic
1155544779 18:26903806-26903828 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1155798757 18:30073847-30073869 AGTCACTCCAGCTCCTGCCATGG + Intergenic
1155809076 18:30208600-30208622 AGCCTCTCCAGTTCCAGCCATGG - Intergenic
1156122699 18:33864039-33864061 AGCCACTCCAGCTCCAGTTGTGG - Intronic
1156615858 18:38783481-38783503 AGCCATGCCAGATCCATCTGTGG - Intergenic
1156778466 18:40821941-40821963 TGCCTCCCCAGCTCCAGCAGGGG - Intergenic
1156904481 18:42337052-42337074 AGCCACTCCAGCTTCAGCCCTGG - Intergenic
1157206364 18:45703526-45703548 AGTTACTCCAGCTTCAGCTGTGG - Intergenic
1158092216 18:53727596-53727618 AGCTGCTCCAGATCCAGCCGTGG - Intergenic
1158129717 18:54139461-54139483 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1158374456 18:56847710-56847732 AGCCACGCCAGCTCCAGCTGTGG + Intronic
1159186592 18:64983689-64983711 AGCCACCCCAACTGCAGCTGTGG + Intergenic
1159288835 18:66390659-66390681 AGCCATTCCAGTTCCAGCTCTGG + Intergenic
1159759524 18:72407791-72407813 GGCCACTCCAGCTCCAGCTATGG + Intergenic
1159767702 18:72509945-72509967 CGCTACCTCAGCTCCAGCTGTGG - Intergenic
1159803070 18:72924110-72924132 AGCCATTCTAGCTCCAGCCATGG - Intergenic
1160247460 18:77170314-77170336 AGCCACTCCTGCTGCTGGTGTGG - Intergenic
1160396236 18:78574322-78574344 AGTCACTCCAGCTCTACCTGTGG + Intergenic
1160476145 18:79190039-79190061 AGCCCCTCCTGCTGCTGCTGCGG - Intronic
1161479570 19:4503785-4503807 AGCCACAGCAGCCACAGCTGGGG - Exonic
1162002721 19:7757628-7757650 AGCTGCTTCAGCCCCAGCTGTGG + Intergenic
1163035622 19:14567310-14567332 AGCCCCTCCACCTGCACCTGGGG + Intronic
1163509343 19:17725944-17725966 GGGCGCTCCGGCTCCAGCTGCGG + Exonic
1163663704 19:18593442-18593464 GGCCACCCCAGCTCCTGCTGAGG + Exonic
1164850932 19:31483582-31483604 GGCTGCTCCAGCTCCAGCTTTGG - Intergenic
1165027076 19:32969815-32969837 AGCCACCCAAACTGCAGCTGTGG - Intronic
1165694836 19:37893136-37893158 TCCCATTCCAGCTCCCGCTGGGG + Exonic
1165697115 19:37908907-37908929 CTGCACTCCAGCTCCAGATGTGG + Intronic
1166307411 19:41942595-41942617 TGCCACTCCAGCTCCAGCCTGGG - Intergenic
1166535477 19:43571371-43571393 CACTGCTCCAGCTCCAGCTGGGG + Intronic
1166623895 19:44332150-44332172 AGCCACTGCAACTCCAGCCTGGG + Intronic
1167638311 19:50667571-50667593 GGCCCCTCCTGCTGCAGCTGGGG - Exonic
1168215389 19:54921445-54921467 AGCCACTCAACCTCCAGGTTTGG + Intergenic
1168309692 19:55454272-55454294 TGCAACTCCTGCCCCAGCTGGGG + Intronic
1168607152 19:57769432-57769454 GGCGACTCCAGGTCCAGATGCGG - Intergenic
925061753 2:896958-896980 AGCCACTCCAACTCCAGCTATGG + Intergenic
925094562 2:1185655-1185677 AGCCACTCCAGCTCCCACCATGG - Intronic
925277341 2:2659617-2659639 AGCCACTACAGCTCCAGCCATGG - Intergenic
925354391 2:3227773-3227795 AGCTGCTGCTGCTCCAGCTGTGG + Intronic
925402396 2:3585072-3585094 AGACACTCCTGCTCCAGCACAGG - Intergenic
925594747 2:5544208-5544230 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
925794973 2:7531305-7531327 AGCTGCTCCAGCTCCAGCCGTGG - Intergenic
926067889 2:9858777-9858799 AGCCACTCCAGCTCCAGCTGTGG - Intronic
926070506 2:9884807-9884829 AGCCACCCAAGCCACAGCTGTGG + Intronic
926174317 2:10575727-10575749 AGCCACCTCAGCTCCTGCAGAGG - Intronic
926467207 2:13205898-13205920 AGCCACTCCACTTCCAGCCATGG + Intergenic
926500203 2:13643903-13643925 AGCTGCTTCAACTCCAGCTGTGG + Intergenic
926611931 2:14955725-14955747 AGCTACTTTAGCTCAAGCTGTGG - Intergenic
926638200 2:15206667-15206689 AGCCACTCAGGCTCCAGCTGTGG + Intronic
926768996 2:16351392-16351414 AGCCACTCCACTTCCAGCTGTGG + Intergenic
927033800 2:19150857-19150879 GGCCACTCTAGCTTTAGCTGTGG - Intergenic
927302807 2:21535814-21535836 GGCCACTCCAGCTCCAGCAGTGG + Intergenic
927617098 2:24609586-24609608 AGCCACTGCACCTCCAGCCTGGG + Intronic
927843052 2:26457406-26457428 AGCGCCTCCAGGCCCAGCTGAGG - Exonic
928199154 2:29236221-29236243 AGCCCCTCCATCTCCAGATGAGG - Intronic
928284647 2:29979167-29979189 CACCACTCCATCACCAGCTGTGG - Intergenic
928451051 2:31379034-31379056 ACTCACTAAAGCTCCAGCTGTGG + Intronic
928696344 2:33853544-33853566 AGCTGCTCCAGCTCCAGCTATGG - Intergenic
928749880 2:34458957-34458979 AGACACTTCAGCTCCAGCCGTGG + Intergenic
928797506 2:35040219-35040241 AGCCACTCCAGTTCCAGCTTTGG + Intergenic
928821999 2:35372775-35372797 GGCCACTCCATTTCCAGCTGTGG + Intergenic
929227088 2:39521948-39521970 AGCCACTCCAGCTCTAGCCATGG - Intergenic
929391232 2:41471407-41471429 AGCTGCTCTAGCTCCAGCTGTGG + Intergenic
930054232 2:47239763-47239785 CCCCACTCCAGCTCCTCCTGGGG + Intergenic
930119452 2:47748212-47748234 AACCACTCCAGTTCCAGCCTTGG + Intronic
930299178 2:49593932-49593954 AGCCACTCCGACTCCAGCCGAGG + Intergenic
930523483 2:52497511-52497533 AGCCACTCCAGCTCTAGCCGTGG + Intergenic
930931221 2:56886043-56886065 GGCCACTCCAGCTCCAGCCTCGG + Intergenic
930961492 2:57267235-57267257 AGCTACTCCAGCTCTAGCGGTGG - Intergenic
931041412 2:58305106-58305128 AGCCACTCCAGCCATGGCTGTGG + Intergenic
931154095 2:59608113-59608135 AGATGCTCCAGCTCCAGCTGTGG + Intergenic
931800944 2:65757036-65757058 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
932492405 2:72130808-72130830 CGCCTCTTCAGCTTCAGCTGCGG + Exonic
932648532 2:73530888-73530910 AGCTGCTCCAGCTCCACCTGTGG - Intronic
932659286 2:73638697-73638719 AGCTTCTCCAGCTCCAGCTTTGG + Intergenic
932665848 2:73698365-73698387 AGCTTCTCCAGCTCCAGCCTTGG + Intergenic
932956466 2:76357067-76357089 AGCTGCTCCAGCTCCAGTTGTGG + Intergenic
933080171 2:77976346-77976368 AGCAACTACAGCTCCAGCAATGG + Intergenic
933445720 2:82377638-82377660 AGCCACTTCAGCTTCTGCAGTGG + Intergenic
933539073 2:83616058-83616080 GGCCGCTGCAGCTCCAGCTGTGG + Intergenic
933539399 2:83619258-83619280 AGTGGCTTCAGCTCCAGCTGTGG - Intergenic
933985799 2:87591303-87591325 AGCTGCTACAGCTCCAGCTGTGG + Intergenic
934118231 2:88815673-88815695 AGCTGCTCCAGCTCCAGCAGTGG + Intergenic
934700825 2:96438834-96438856 AGCCACTGCAGCTTCAGTTGTGG + Intergenic
935324578 2:101924792-101924814 AGACACTTCAGCTCCAGCAGTGG + Intergenic
935324923 2:101927387-101927409 AGCCACTGTAGCTCCAGTCGTGG + Intergenic
935329978 2:101969755-101969777 GGCTGCTCTAGCTCCAGCTGTGG - Intergenic
935385243 2:102492537-102492559 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
935425816 2:102917292-102917314 AGCCTTTCCAGCTCCAGCCATGG - Intergenic
935792119 2:106602125-106602147 AGCGGCTCTAGCTACAGCTGAGG - Intergenic
935797951 2:106663794-106663816 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
936308043 2:111359501-111359523 AGCTGCTACAGCTCCAGCTGTGG - Intergenic
936736173 2:115446062-115446084 AGCTGCTCCAGCTCCAGCCATGG + Intronic
936788806 2:116125701-116125723 AGCTGCTCCAGATCCAGCTGTGG - Intergenic
936814685 2:116445171-116445193 AGCCTCTCCAGCTCCAGCTGTGG - Intergenic
936898305 2:117454639-117454661 AGCCACTCTGGCTTCAGCTGTGG + Intergenic
936905725 2:117533851-117533873 AGCCACTTCAGGTCCATCTGGGG + Intergenic
937250260 2:120519374-120519396 GACCACTCCAGCTCCCACTGGGG - Intergenic
937380723 2:121374169-121374191 AGCTGCTCCAGCTCCAGCTATGG + Intronic
937465321 2:122127320-122127342 AGCTACCCCAGTTTCAGCTGTGG + Intergenic
937491416 2:122371837-122371859 AGCCGCTCCAGCTCCAGCCATGG - Intergenic
938195032 2:129319405-129319427 AGCCACCCAACCTGCAGCTGTGG - Intergenic
938222390 2:129581284-129581306 AGCAACTCCAGCTCCAGCCTTGG - Intergenic
938709926 2:133967487-133967509 AGCCACTGCAACTCCTGCCGAGG + Intergenic
938718186 2:134039999-134040021 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
938795990 2:134718784-134718806 TGCCGCTCCTCCTCCAGCTGGGG + Exonic
938974169 2:136459435-136459457 AGCCACTTCAGCTCCAGCCATGG - Intergenic
939243600 2:139594447-139594469 AGGCACTCCAGCTTCAACTGTGG + Intergenic
939361225 2:141175420-141175442 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
939364624 2:141216168-141216190 AGCCACTACAGCACCAGCCAGGG + Intronic
939445999 2:142310655-142310677 AGCCACTCCATCTCCAGCCATGG - Intergenic
939667090 2:144965430-144965452 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
940121932 2:150276860-150276882 AGCCACTCTAGCTCCAGCCATGG - Intergenic
940192927 2:151061670-151061692 AGCCAGTCCAGGTCCAGGTGAGG + Intergenic
940402900 2:153267550-153267572 TGCCACTCCAGCTCTAGCCATGG - Intergenic
940499633 2:154477986-154478008 AGCCACTTCAGCTCTAGCCATGG + Intergenic
940612095 2:156005752-156005774 AGACACACCAGCTGCTGCTGTGG + Intergenic
940729819 2:157375765-157375787 AGTTGCTCCAGCTTCAGCTGTGG - Intergenic
940826270 2:158416142-158416164 AGCCACTCCAGCTCCAGCCATGG - Intronic
941888371 2:170552892-170552914 AGCCGATCTAGCTTCAGCTGTGG + Intronic
942644521 2:178095880-178095902 AGCCACTCCAGTTCCAACTATGG - Intronic
942644656 2:178096865-178096887 TGCCACTCCAGTTTCAGCTATGG - Intronic
943124754 2:183782629-183782651 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
943143931 2:184018273-184018295 AGCCACTCCAGCTCCAGCCATGG + Intergenic
943283849 2:185972098-185972120 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
943297838 2:186160918-186160940 AGCCACTCTAGCTCCAGCTATGG + Intergenic
943395528 2:187328642-187328664 AGCCACTCCATCCCCAGCCATGG + Intergenic
943427096 2:187750384-187750406 AGCCACTCAAGCCACGGCTGTGG - Intergenic
943493448 2:188585632-188585654 AGCCACTCCAGCTCTAGCCATGG - Intronic
943720443 2:191198601-191198623 ACCTGATCCAGCTCCAGCTGTGG + Intergenic
943880073 2:193131723-193131745 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
944037010 2:195307263-195307285 TGTCACTGTAGCTCCAGCTGAGG - Intergenic
944264186 2:197706064-197706086 AGCCACTCCAGCGGTGGCTGCGG + Exonic
944371214 2:198985665-198985687 AGCCTCTCCAGCTCTAGTTGTGG - Intergenic
944477939 2:200126010-200126032 TTCAGCTCCAGCTCCAGCTGTGG - Intergenic
944479779 2:200144688-200144710 GGCCACTCTTGCTCCAGCCGTGG - Intergenic
944491515 2:200262759-200262781 AGTCACTCCAGCTCTAGCCATGG + Intergenic
944943104 2:204651931-204651953 AGCCACTCCAGTTCCAGCCATGG - Intronic
945109583 2:206349493-206349515 AGCCACTCTAGCTTCAACCGTGG - Intergenic
945328780 2:208515219-208515241 TGCCACTCCAGCACCAGCCATGG - Intronic
945336635 2:208600037-208600059 AGCCACTCCAGCTCCAACTGTGG - Intronic
945515905 2:210762928-210762950 AGCCATTCCAGCTCCAGCCATGG - Intergenic
945900654 2:215534000-215534022 AGCCACTCCAGCTCCAGCCATGG + Intergenic
946317168 2:218923967-218923989 AGCCACTCCAGCTCTAGCCATGG - Intergenic
946400898 2:219468035-219468057 AGCCCCTCCAGCTTCCGCTTAGG - Intronic
946898146 2:224345610-224345632 TGCCACTCCAGCTCCAGCTGTGG - Intergenic
946937409 2:224736435-224736457 AGCTGCTCCAGTTCCAGCTGTGG + Intergenic
947073679 2:226318826-226318848 AGCCACTCTAGCTGCAGGTGGGG + Intergenic
947178090 2:227387745-227387767 AGCCACACGAGCTGCAGGTGCGG + Intergenic
947215496 2:227746118-227746140 AGCCACACGAGCTGCAGGTGCGG - Intergenic
947838038 2:233189288-233189310 GGACACTCCAGGCCCAGCTGGGG + Intronic
948104213 2:235400173-235400195 AGCCACTCCAGCTCCAGCCATGG + Intergenic
948292433 2:236835723-236835745 AGCCACTCCAGCTCCAACCATGG - Intergenic
948598595 2:239095905-239095927 TGTCACTCCAGCTCCAGCCCAGG - Intronic
948773162 2:240262787-240262809 AGCCACTCCAGCTCCAGCCATGG + Intergenic
948993014 2:241564225-241564247 AGGCACTCCAGCACATGCTGTGG - Intronic
1168886019 20:1256718-1256740 TGCCACTGCAACTCCAGCTTGGG - Intronic
1169414392 20:5403429-5403451 TCCAGCTCCAGCTCCAGCTGTGG - Intergenic
1169980588 20:11379818-11379840 AGCCTCTCTGGCTCCAGCAGGGG - Intergenic
1170110092 20:12795682-12795704 AGCTAGTCCATCTCCAGCTGTGG + Intergenic
1170150361 20:13221302-13221324 GGCCGCTCCCGCTCCAGCTGCGG + Intergenic
1170938530 20:20829949-20829971 AGCTGCTCCAGCTCCAGCCACGG + Intergenic
1170941687 20:20853501-20853523 AGCTGCTCCATTTCCAGCTGTGG - Intergenic
1171001905 20:21423441-21423463 AGCCACTGTAGCTCCAGCCGTGG - Intergenic
1171133185 20:22674015-22674037 AGCTACTCCAGGTGCAGCAGAGG + Intergenic
1171169444 20:23002183-23002205 AACCAGTCCTGCTGCAGCTGTGG - Intergenic
1171399656 20:24864697-24864719 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1171452563 20:25246850-25246872 AGCCCACCCAGCTCCAGCTCGGG - Intergenic
1171490648 20:25514745-25514767 AGCTGCTCCAGCTCCAGCCATGG + Intronic
1173098457 20:40061008-40061030 AGCCACTTCAGCTCCAGCCATGG + Intergenic
1173101368 20:40091811-40091833 TGCTCCTCCAGCTCCAGCTGTGG - Intergenic
1173314544 20:41931447-41931469 AGCTGCCCCAGCTCCAGCTGTGG - Intergenic
1174531444 20:51217726-51217748 GGCCACTTCAGCTCCAGCCATGG - Intergenic
1174543345 20:51306817-51306839 CCCCACCCCACCTCCAGCTGTGG + Intergenic
1174759760 20:53195494-53195516 AGCCCCTCAAGCACCATCTGAGG - Intronic
1174897901 20:54470209-54470231 TGCCATTCCAGCTTCAGCTTTGG + Intergenic
1175013621 20:55764900-55764922 AGCTGCTCCAGCTCCAGCTATGG - Intergenic
1175188206 20:57194046-57194068 ATCCCCTGCAGCTCCTGCTGGGG + Intronic
1175268197 20:57715115-57715137 GGCCACTCCAGCACCTGCTCTGG + Intergenic
1175681221 20:60990143-60990165 AGCCCCTCCAGCAGCAGCAGTGG - Intergenic
1175714683 20:61247481-61247503 AGCGGCTCCCGCTCCAGCAGAGG + Intergenic
1175724556 20:61308993-61309015 AGTCAGTCCTGCTCCAACTGAGG - Intronic
1175832829 20:61976467-61976489 CAGCACCCCAGCTCCAGCTGTGG - Intronic
1175913836 20:62416577-62416599 GGCCACACCAGCGCCGGCTGGGG + Intronic
1176233145 20:64042118-64042140 AGGCCCCCCTGCTCCAGCTGTGG + Intronic
1176925634 21:14745601-14745623 AGCTGCTCCAGCTCTAGCCGTGG - Intergenic
1176976004 21:15322884-15322906 AGCCACTGCAACAACAGCTGAGG - Intergenic
1177187007 21:17808188-17808210 AGCCACTTCAGCTCCAGCCATGG + Intronic
1177212012 21:18083165-18083187 AGCCACTCCAGCTCCAGCCATGG + Intronic
1177236145 21:18391978-18392000 AGCCACTCCAGCTCCAGCCATGG - Intronic
1177306072 21:19317482-19317504 AACCACTACAGCTCCAGCTGTGG - Intergenic
1177402463 21:20623556-20623578 AGCCACTCTAGCTCCTGCTGTGG - Intergenic
1177473068 21:21583955-21583977 AGCTACTTCAGCTCCAGCCATGG + Intergenic
1177835759 21:26184705-26184727 AGCCACTCCAGCTCCAGCTGCGG - Intergenic
1178127051 21:29526939-29526961 AGCTACTCCAGTTCCAGCCATGG - Intronic
1178154230 21:29832616-29832638 AGCAGCTCCAGCTCCAGCCATGG - Intronic
1178482490 21:32991643-32991665 ATCAGCTCCATCTCCAGCTGAGG + Intergenic
1179471814 21:41615399-41615421 TGGCACTCCAGCTCCAGCCTGGG + Intergenic
1180153418 21:45964880-45964902 TGCCATTTCAGCTCCAGCTGTGG + Intergenic
1180716559 22:17876531-17876553 ATCCTCTCCAGCTCCCTCTGGGG - Intronic
1180939576 22:19649429-19649451 AGCCACTCCAGCTCCTTTTTGGG - Intergenic
1181027912 22:20136182-20136204 AGACACTCCACCTCCAGCCCAGG + Intronic
1182280933 22:29217339-29217361 AGCCAGGCCAGCTCCCTCTGTGG + Intronic
1182618540 22:31604960-31604982 CGCCTCCCAAGCTCCAGCTGGGG + Intronic
1182676399 22:32042925-32042947 AGCCACTCCAGCTCTGGCAAGGG + Intergenic
1182724477 22:32432316-32432338 TGCCAATCCTGCTCCTGCTGTGG - Intronic
1182816789 22:33171562-33171584 AGCCACTCCAGCTCCAGCTGTGG + Intronic
1182945284 22:34316182-34316204 AGCCACTTTAGTTCCAGCTGTGG + Intergenic
1182956887 22:34434980-34435002 ATCCACTTCATCCCCAGCTGAGG + Intergenic
1182967544 22:34536081-34536103 AGCGACTCCACCTCTAGCTATGG - Intergenic
1183202392 22:36394596-36394618 GGCCACTGCAGCTCCAGCCTGGG - Intergenic
1183414937 22:37676567-37676589 AGCCACTTCCTCTCCAGCAGAGG + Intronic
1184292246 22:43503632-43503654 AGCTACTCCAGGGCCAGGTGAGG - Intronic
1184335154 22:43848577-43848599 AGCGACTCCAGCTCCAGGCGTGG - Intronic
1184490371 22:44804835-44804857 TGCCACTGCAGTTTCAGCTGTGG - Intronic
1184514429 22:44953181-44953203 AGCCATTTCTGCCCCAGCTGCGG - Intronic
1184943866 22:47787335-47787357 AGCTGTTTCAGCTCCAGCTGTGG + Intergenic
1185260396 22:49858552-49858574 AGTCACGGTAGCTCCAGCTGGGG - Intronic
949128140 3:470869-470891 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
949408985 3:3743338-3743360 AGACACACCAGCCCCAGCAGAGG + Intronic
949491076 3:4589621-4589643 GACCACTCCAGCTCCAGCCATGG - Intronic
950375646 3:12570088-12570110 AGCACCTCCAGCTGCAGCAGAGG - Exonic
950776072 3:15351634-15351656 AGGTGCTCCAGCTCCAGCTGTGG + Intergenic
951132870 3:19069023-19069045 AGCCACTCCAGCTCCAGCCATGG + Intergenic
951180698 3:19655035-19655057 AGCCACTCCAGCTCCAGCCATGG - Intergenic
951385024 3:22031519-22031541 AGCCGCTCCAACTCCAGCCGTGG - Intronic
951553618 3:23899018-23899040 AACCACCCCATCTCCATCTGTGG + Intronic
951798321 3:26566752-26566774 AGCCACCCAAGCTGCAGGTGTGG - Intergenic
951937018 3:28033192-28033214 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
952141142 3:30480374-30480396 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
952220027 3:31315741-31315763 AACCACTCCAGCTCCAGCCATGG + Intergenic
952221408 3:31327468-31327490 AGCCACTCCAGTTCCAGCCTTGG - Intergenic
952480246 3:33753899-33753921 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
952504548 3:33995992-33996014 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
952674300 3:36008499-36008521 AGCCACTCCAGCTTCAGCCATGG - Intergenic
952735063 3:36681078-36681100 GGCTGCTCCAGCTCCAGCTGTGG - Intergenic
953095006 3:39766507-39766529 AGCCACTCCAGCTCCAGCCATGG - Intergenic
953115641 3:39989848-39989870 AGCCTCCCCAGCTCCAGCAGGGG + Intronic
953410710 3:42689112-42689134 AGGGACTGCAGCTCCTGCTGGGG - Intronic
953490524 3:43346492-43346514 GGCAACTCCAGCTCCAGGTTGGG + Intronic
953624854 3:44562268-44562290 AGCCACTCCAGCTCCAGCTGTGG - Intronic
953785026 3:45904963-45904985 GGCCACTCCAGCTTCACCGGAGG + Intronic
953824111 3:46235020-46235042 AGCCACTCCACCTCCAGTAGAGG - Intronic
953972709 3:47359561-47359583 GACCACTCCAGCTCCAGCCAGGG + Intergenic
954053444 3:48002163-48002185 AGCCACCACAACTCCAGGTGTGG + Intronic
954291513 3:49652434-49652456 AGGCTCTCCATCTCCAGCTCAGG - Exonic
954580930 3:51702570-51702592 AGCCAAGCCAGGTGCAGCTGGGG - Intronic
954834702 3:53455640-53455662 GGCCACTCCAACTCCAGCTCTGG + Intergenic
955864765 3:63371349-63371371 AGCCACTGCAGCTCTGGCAGTGG + Intronic
956354634 3:68377828-68377850 AGCTGCTCCAGCTCCAGCCATGG + Intronic
956572571 3:70712830-70712852 AGCCACTCTAGCTCCAGCAATGG - Intergenic
956978988 3:74614671-74614693 CGCCACTCCGGCTCCGGCTCCGG + Intergenic
957293410 3:78306490-78306512 AGCCACTCCAGCTTCAGCCATGG + Intergenic
957374294 3:79336383-79336405 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
957403113 3:79742364-79742386 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
957477136 3:80739580-80739602 AGCTGCTTCAACTCCAGCTGTGG - Intergenic
957490562 3:80921547-80921569 AGCTGCTTCAGCTCCAGCTATGG + Intergenic
957524113 3:81358059-81358081 AGCCACTCCAGGTTCAGCTGTGG + Intergenic
957609462 3:82448911-82448933 AGCCCCTTCAGCTCTAGTTGTGG + Intergenic
957705033 3:83770059-83770081 AGCCACCCAAACTGCAGCTGTGG + Intergenic
957768559 3:84658421-84658443 AGCCACTCCAAATCCAGCCATGG + Intergenic
957783480 3:84849419-84849441 AGCCCCTCCAGCTCCAGCTGTGG - Intergenic
957857265 3:85894734-85894756 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
957982259 3:87525445-87525467 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
958006026 3:87812786-87812808 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
958256559 3:91332055-91332077 GGCTGCTCCAGTTCCAGCTGTGG + Intergenic
958560510 3:95742910-95742932 AGCCACTCCAGCTTCAGTCATGG - Intergenic
958582549 3:96045203-96045225 AGTCACTCTAGCTCCAACTGTGG - Intergenic
958583891 3:96061458-96061480 AGCCACTCCAGCTCCAGCCATGG + Intergenic
958650280 3:96929143-96929165 AACCACTTGAGCTCCAGTTGTGG - Intronic
958672200 3:97219552-97219574 AGTCACTCCAGCTTCAGCCATGG - Intronic
958836850 3:99156573-99156595 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
958893466 3:99805275-99805297 AGCCATTCTCGCTCCAGCTGTGG - Intergenic
959023395 3:101213995-101214017 AGCCACTCCAGCTCCAGCCATGG + Intergenic
959125263 3:102283298-102283320 AGCTGCTCCAACTCCAGCTGTGG + Intronic
959149445 3:102591147-102591169 AGCCACTCCATCTCCAGCCATGG + Intergenic
959214817 3:103437800-103437822 AGCTGCTCTACCTCCAGCTGTGG - Intergenic
959252636 3:103966882-103966904 AACCACTCCAGCTGCTGCAGTGG - Intergenic
959283622 3:104379590-104379612 GGCCACTCCACCTCCAGCTTTGG + Intergenic
959284596 3:104391387-104391409 AGCCATTCCAACTCCAGCCATGG - Intergenic
959418383 3:106104390-106104412 AGCCTCCCCAGCTCCACCAGGGG + Intergenic
959507754 3:107174922-107174944 AACTGCTTCAGCTCCAGCTGTGG - Intergenic
959507900 3:107176114-107176136 AGGTGCTCCAACTCCAGCTGTGG + Intergenic
959508235 3:107178253-107178275 AGCTCCTCCAGCTCCAGCTGTGG - Intergenic
959809205 3:110595052-110595074 AGCCCCTCTGGCTCCAGCTGTGG - Intergenic
960101163 3:113745571-113745593 AACCACTCCACCTGGAGCTGCGG + Intronic
960151320 3:114251551-114251573 AGTCTCTCCAGCTTCAGCAGGGG - Intergenic
960224910 3:115157801-115157823 AGCTGCTTCAGCTCCATCTGTGG + Intergenic
960256529 3:115516750-115516772 AGCCACTCCAGCTCCAGCCATGG - Intergenic
960413724 3:117359028-117359050 AGCCCCTCTGGCTCCAGCAGGGG - Intergenic
960492339 3:118332976-118332998 AGCCACACCAGCTTCAGTTTTGG + Intergenic
960538465 3:118839259-118839281 AACCACTCCAGTTCCAGCCATGG - Intergenic
960581430 3:119282570-119282592 AGCTGCTCCAGCCCCAGCTGTGG + Intergenic
960622192 3:119647805-119647827 AGCCCCTTAAGCCCCAGCTGTGG + Intronic
960670998 3:120155238-120155260 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
960724753 3:120658898-120658920 AGCTGCTCCAGCTCCTCCTGTGG - Intronic
960769567 3:121178685-121178707 ATCCATTCCAGCTCCAGGTAAGG - Intronic
960849444 3:122036898-122036920 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
961481284 3:127182767-127182789 GGCCACTGTAGCTGCAGCTGGGG - Intergenic
961503836 3:127356963-127356985 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
962066981 3:131991841-131991863 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
962162366 3:133012984-133013006 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
962456157 3:135567438-135567460 GGCCTCTCCAGGGCCAGCTGTGG + Intergenic
962622535 3:137194058-137194080 AGCCACTACAGCCACTGCTGTGG + Intergenic
963003641 3:140706028-140706050 GGCTGCTCCAGCTCCAGCTATGG - Intergenic
963231202 3:142910346-142910368 GGCCACCCCAGTTCCAGCTGAGG + Intergenic
963404435 3:144844329-144844351 AGCTGCTTCAGCTCCAGCGGTGG - Intergenic
963494867 3:146045828-146045850 AGCCACTCCAACTCCAGCTATGG - Intergenic
963515808 3:146306622-146306644 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
963516602 3:146316839-146316861 AGCTGCTTCAGCTCCAGATGTGG - Intergenic
963671590 3:148258379-148258401 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
963996605 3:151717030-151717052 CGCTGCTCCAGCTCCAACTGTGG - Intergenic
964026463 3:152080146-152080168 AGCAGCTCCAGCTCCAGCCATGG - Intergenic
964279879 3:155052568-155052590 AGCTACTTCAGCTCCAGCTGTGG - Intronic
964545450 3:157828814-157828836 GGCCACTCCAGCTCCAGCTGGGG - Intergenic
964791953 3:160460737-160460759 AGCCACCCAAACTGCAGCTGTGG - Intronic
964920013 3:161885077-161885099 GGCTGCTCCAGCTCCAGCTTTGG + Intergenic
964974839 3:162606111-162606133 AGCCACTCCAGCCCCAGCCATGG + Intergenic
965066605 3:163857940-163857962 AGCCACTTCAGCTCCAGTGGTGG + Intergenic
965090023 3:164149866-164149888 AGCCTCTCCAGCTCCAGTCACGG - Intergenic
965112718 3:164448432-164448454 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
965189204 3:165506559-165506581 AGCCACTCCAGCTCAAGCCATGG - Intergenic
965234007 3:166091324-166091346 AGCTGCTCCAGCTATAGCTGTGG - Intergenic
965265045 3:166532103-166532125 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
965342032 3:167503082-167503104 TGCAGCTCCAGCTCCAGCTGTGG + Intronic
965395014 3:168152679-168152701 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
965404892 3:168256027-168256049 AGCCACTCCTGCTCCAGCCATGG - Intergenic
965455632 3:168896548-168896570 AGCCACTCCAGGTCCAGGAATGG - Intergenic
965647283 3:170897480-170897502 AGCCACTCCAGCTCCAGCTGTGG + Intronic
965857261 3:173103568-173103590 GGCCATTCCAGCTCCAGCTGCGG - Intronic
965884217 3:173424135-173424157 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
966302671 3:178496689-178496711 AGCCACTCCAGCTCCAGCCATGG + Intronic
966346920 3:178990412-178990434 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
966452595 3:180078710-180078732 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
966761024 3:183419184-183419206 AGCCACTCCAGCTGTAGCTGTGG - Intronic
966944684 3:184769517-184769539 AGCCGCTCCAGCTAAAGCAGGGG - Intergenic
967260254 3:187634760-187634782 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
967396556 3:189015670-189015692 AGCTACTCCTGCTTAAGCTGTGG + Intronic
967406178 3:189118627-189118649 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
967453338 3:189651815-189651837 AGATGCTTCAGCTCCAGCTGTGG + Intronic
967559465 3:190901409-190901431 AGCCACTCCTGTGCCAGTTGTGG + Intergenic
967567382 3:190988352-190988374 GGTCACTTCAGCTCCAGCTGTGG + Intergenic
967600110 3:191376511-191376533 AGCCAGTCAAGCTCTATCTGTGG + Intronic
967805938 3:193714795-193714817 GGCCACTCCAGCTTCAGCTGTGG + Intergenic
968218571 3:196915629-196915651 ACCCAGTCCAGTGCCAGCTGTGG + Intronic
968588570 4:1446314-1446336 GGCCACCCCAGCTCCAGCCCTGG - Intergenic
968695870 4:2026197-2026219 AGCCACTCCAGCCCCAGCTGTGG - Intronic
969103601 4:4788591-4788613 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
969107952 4:4822257-4822279 AGCCACTCCAGCTCCAGCTGCGG + Intergenic
969312106 4:6359705-6359727 AGCCACACCAGCCCCACGTGAGG + Intronic
969322962 4:6424153-6424175 AGCCCCTGGAGCTCCAGCTCTGG + Intronic
969780113 4:9394813-9394835 AGCCACTCCAGCTCCAGCCATGG + Intergenic
970036153 4:11738231-11738253 AGCCACTCCAGCTGCAGCCATGG + Intergenic
970100351 4:12514639-12514661 AGCCACTCCAGCTCTAGCTGTGG + Intergenic
970142091 4:12994013-12994035 GGCCACTCCAGCTCCAGCTGTGG - Intergenic
970150303 4:13082222-13082244 AGCCACTCTAGCTCCAGCCATGG - Intergenic
970461252 4:16277070-16277092 AGCCATTCCAGCCCCAGCCATGG + Intergenic
970659237 4:18265290-18265312 AGCCACTCCAGCTCCAGCCATGG - Intergenic
971252745 4:24986826-24986848 AGCCTCTACTGCTCCAGCTATGG - Intergenic
971277933 4:25215641-25215663 AGCCACTTCAGCTCCAGCCGTGG - Intronic
971545484 4:27880169-27880191 AGTCACTCCAGCTCCATCTATGG - Intergenic
971557863 4:28036906-28036928 AGCCACTCTAGCTTCAGCTGTGG - Intergenic
971593360 4:28497260-28497282 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
971598971 4:28568591-28568613 AGTCACGCCAGCTCAAGCTATGG - Intergenic
971720948 4:30244556-30244578 AGTCACTCCAGCTCCAGCCATGG - Intergenic
971845768 4:31916254-31916276 ATCTGCTTCAGCTCCAGCTGTGG + Intergenic
971848085 4:31946237-31946259 AGCCATTCCAGTTCCAGCCTTGG + Intergenic
971856761 4:32054106-32054128 AGCCACTCCGGCTCCTGCCATGG - Intergenic
971892602 4:32544321-32544343 AACCACTTCAGCTCCAGCTGTGG + Intergenic
971943632 4:33246100-33246122 AGCCACTCCAGCTCCAACTGTGG - Intergenic
971972203 4:33634945-33634967 AGTCACTCCAGCTCCAGTCATGG + Intergenic
972011627 4:34190233-34190255 GGTCACTCCAGCTCCAGACGTGG + Intergenic
972079816 4:35136773-35136795 AGCCAATCCAGCTCCAACTGTGG - Intergenic
972101951 4:35431455-35431477 AGCCACTCTAGTTCCAGCTGTGG + Intergenic
972128490 4:35800939-35800961 AGCCACCCAAACTGCAGCTGTGG + Intergenic
972192884 4:36616029-36616051 AGCTGCTCCAGCTCCAGCCCCGG - Intergenic
972413436 4:38815564-38815586 AGCCACTCTAGCTCCAACAATGG - Intronic
972829915 4:42802862-42802884 AACCACTTCAGCTCCAGCCATGG - Intergenic
972844429 4:42970583-42970605 AGCAACTCCAGCTCCAGCTTTGG - Intronic
972911529 4:43822745-43822767 GGCCAATCCAGTACCAGCTGTGG - Intergenic
972976616 4:44643711-44643733 GGCCACTCCAGCTCCAGCCTTGG + Intronic
973046575 4:45541397-45541419 AGCCACTCCAGCTTCAGCAGTGG + Intergenic
973131560 4:46654152-46654174 TGCCACTCCAGCTCCAGCCTTGG - Intergenic
973665353 4:53153425-53153447 GGCCACTCCAGCTCCAGCTGTGG - Intronic
973780414 4:54283433-54283455 TATGACTCCAGCTCCAGCTGTGG - Intronic
974101477 4:57422270-57422292 AGCTGCTTCAGCTCTAGCTGTGG + Intergenic
974492821 4:62588814-62588836 AGTCGCTTCAGTTCCAGCTGTGG - Intergenic
974564238 4:63563535-63563557 AGGTACACCTGCTCCAGCTGCGG - Intergenic
974608471 4:64184070-64184092 AGCCACTTCAGCTCCAACTGTGG - Intergenic
974625923 4:64429110-64429132 AACTTCTCCAGCTCCAGCTATGG + Intergenic
974702773 4:65472655-65472677 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
974806085 4:66882687-66882709 AGCTACTCTAGCTCCAGCCATGG + Intergenic
974973316 4:68858558-68858580 ATCTGCTCTAGCTCCAGCTGTGG + Intergenic
975609858 4:76193103-76193125 AGCCACTCCAGCTCCAGACATGG + Intronic
975629005 4:76380876-76380898 AGCTGCTCCAGCTCCAGCCATGG + Intronic
975656721 4:76648636-76648658 ACCCACTCCAGATCCAGATTCGG + Intronic
975728955 4:77319328-77319350 AGCTGCTCCAGTTCCAGCTGGGG - Intronic
976000802 4:80371172-80371194 AGCCACCCCAGCTCCAGCTGTGG - Intronic
976141958 4:82002244-82002266 AGTCACTCCAGCTCCAGCAATGG + Intronic
976287590 4:83385197-83385219 AGCTGCTCCAGCTCCAACTGTGG - Intergenic
976318589 4:83685886-83685908 AGACACTCCAGCTCCACCGAGGG - Intergenic
976635958 4:87286715-87286737 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
976700906 4:87967371-87967393 AGACACGCCAGCTGCTGCTGCGG - Intergenic
976706691 4:88026812-88026834 AGCCACTCCAGCTCCAGCTGTGG + Intronic
976805006 4:89036784-89036806 AATCACTCCAGCTCCAGCCATGG + Intronic
976912286 4:90322844-90322866 ACCCAGTGCAGTTCCAGCTGTGG - Intronic
976988086 4:91327400-91327422 AGACTCTCCAGCTCCAGCCATGG - Intronic
977197524 4:94081501-94081523 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
977783405 4:101005723-101005745 AGAAGATCCAGCTCCAGCTGTGG + Intergenic
977983941 4:103360174-103360196 AGACATGCCAGCTCCAGCTGTGG + Intergenic
977989258 4:103421041-103421063 AGCCACTCCAGCTCCAGCCATGG - Intergenic
978213183 4:106162728-106162750 AGTGACTTCAGCTTCAGCTGTGG - Intronic
978267086 4:106839545-106839567 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
978408669 4:108405844-108405866 AGTTGCTCCAACTCCAGCTGTGG - Intergenic
978444319 4:108766056-108766078 TGCCACTCCAGCTCCAGCCTAGG + Intergenic
978492472 4:109323491-109323513 AGCCACTCCACCTCCAGCCATGG - Intergenic
978809726 4:112837164-112837186 AGCAGCTCCAGTTCCAGCTGTGG + Intronic
978983655 4:114982900-114982922 AGCCACTCCAGCTCCAGCCATGG + Intronic
979060911 4:116059337-116059359 AGCTGCTACAGCTCCAGCTATGG - Intergenic
979137487 4:117127903-117127925 AGCTACTTCAGCTCCAGCCATGG + Intergenic
979373268 4:119914539-119914561 AGCTGTACCAGCTCCAGCTGTGG - Intergenic
979948210 4:126860496-126860518 AGCTGCTCCAGCTGCAGCCGTGG - Intergenic
979969241 4:127114161-127114183 AGCCACTCCAGCTCCACCCATGG + Intergenic
980090825 4:128441298-128441320 AGCCACTCCAGCTTCAGCCATGG - Intergenic
980153731 4:129080001-129080023 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
980247543 4:130267076-130267098 AGCCACTCCACTTCCAGCCATGG + Intergenic
980448624 4:132943265-132943287 AGCTGCTCCGGCTCCAGCTGTGG - Intergenic
980559980 4:134460246-134460268 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
980562128 4:134491049-134491071 AGCAACAGCAGCTGCAGCTGTGG - Intergenic
980750199 4:137077512-137077534 AGCCACCCAAACTGCAGCTGTGG - Intergenic
980775450 4:137430873-137430895 CGCCATTCCAGCTCCAGCCATGG + Intergenic
980830655 4:138126770-138126792 GGCCACTCCAGCTCCAGCCTTGG + Intergenic
981131353 4:141161719-141161741 AGCTGCTCCATCTCTAGCTGTGG + Intronic
981176884 4:141692165-141692187 AGCCACTCCAGCTCCAGCTGTGG - Intronic
981242372 4:142493013-142493035 AGCTGCTTCAGCTTCAGCTGTGG + Intronic
981260047 4:142708520-142708542 AGCCACTCCAGCTCCACCTGTGG + Intronic
981356893 4:143799309-143799331 AGTCACTCCAGCTCCAGCTGTGG - Intergenic
981359606 4:143831478-143831500 AGCCCCTCTAGCTCCAGCCATGG + Intergenic
981368424 4:143929906-143929928 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
981370366 4:143952546-143952568 AGCTACTCCAGCTCCAGCTGTGG + Intergenic
981378221 4:144040191-144040213 AGTCACTCCAGCTCCAGCTGTGG - Intergenic
981380125 4:144062470-144062492 AGCCACTCCAGCTCCAGTTGTGG + Intergenic
981503127 4:145473590-145473612 AGCCCCTCCAGCTCCAGCCATGG - Intergenic
981959749 4:150522660-150522682 GGCCACCCCAGCTATAGCTGAGG + Intronic
982207979 4:153011397-153011419 AGCCACTCCAGCTCCAGCGATGG - Intergenic
982222270 4:153135046-153135068 AGCCACTCCACGTCAAGCTGTGG + Intergenic
982304264 4:153913517-153913539 ATCCATTCCAGATCCAGTTGAGG - Intergenic
982390926 4:154863071-154863093 CACTGCTCCAGCTCCAGCTGTGG - Intergenic
982428870 4:155298772-155298794 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
982504957 4:156205689-156205711 AGCAGCTCCAGTTCCAGCCGTGG - Intergenic
982521025 4:156416818-156416840 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
982607892 4:157537623-157537645 AGCCACTCCAGCTCCAGCCATGG + Intergenic
982790580 4:159586914-159586936 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
982797603 4:159664247-159664269 AGCTGCTCCAGCTCCAGTTGTGG - Intergenic
982805232 4:159755057-159755079 AGCTGCTCTAGCTCCAGCTGTGG + Intergenic
982834718 4:160109451-160109473 TGCTGCTCCAGCTCCAGCTGTGG - Intergenic
982904305 4:161048731-161048753 AGATGCTTCAGCTCCAGCTGTGG - Intergenic
982917239 4:161227593-161227615 AGCCACTCCAGCTCCAGTTGTGG - Intergenic
982920425 4:161267255-161267277 AGCTGCTTCAGCTCCAGTTGTGG - Intergenic
983015513 4:162607811-162607833 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
983020481 4:162670102-162670124 AGCTGCTTCAGCTCCAGCCGTGG - Intergenic
983075200 4:163317180-163317202 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
983132871 4:164043436-164043458 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
983171442 4:164540822-164540844 AGCAACTCCAGCTCCAGCTGTGG - Intergenic
983178091 4:164615222-164615244 AGACATTCCAGCTCTAGGTGAGG - Intergenic
983469331 4:168137057-168137079 AGCTGCTCCAGCTCCAGCCTTGG - Intronic
983475065 4:168203489-168203511 AGCTACTCCAGCTCCAGGAGTGG + Intergenic
983491785 4:168398074-168398096 AGCCACCCAAGCTGCAACTGTGG + Intronic
983513243 4:168631375-168631397 AGCCACTCCCCATTCAGCTGTGG - Intronic
983854980 4:172632855-172632877 AGCTGCTTCAGCTCCAGCTATGG + Intronic
983904192 4:173168298-173168320 AGCGACTCCAGGTCCAACGGAGG + Intergenic
983952773 4:173661928-173661950 AGCCACTCTAGCTCCAGACGTGG + Intergenic
983972291 4:173890032-173890054 AGGAACTCCAGTTCCAGCTGAGG - Intergenic
983985958 4:174060865-174060887 GCCAGCTCCAGCTCCAGCTGGGG - Intergenic
984057038 4:174942555-174942577 AGCCACTCCAGCTCCAGCTGTGG - Intronic
984325083 4:178241597-178241619 AGCCACCCAAGCCGCAGCTGTGG + Intergenic
984372150 4:178882231-178882253 AGCTGCTCCAGCTCCTGCTGTGG + Intergenic
984436737 4:179719029-179719051 AGCTGCTCCAGCTCTAGCAGTGG - Intergenic
984571945 4:181404842-181404864 AGGCGCTCCAGTTTCAGCTGTGG - Intergenic
984865513 4:184277238-184277260 AGCCATTCCAGTTTCAGCTGTGG + Intergenic
985368612 4:189260908-189260930 AGCCACTCCAGCTCCAACTGTGG - Intergenic
985381976 4:189404510-189404532 AGCCTCTCCAGCTGCAGCTGTGG + Intergenic
985386356 4:189452232-189452254 AGGCACTCCAGCTGCAGCTGTGG + Intergenic
985617062 5:929427-929449 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
985617789 5:934496-934518 AGTTGCTTCAGCTCCAGCTGTGG - Intergenic
985626283 5:990269-990291 AGCCGCTCTTGCCCCAGCTGCGG + Intergenic
986014652 5:3747497-3747519 AGCCACTCCAGGTCCACCCATGG + Intergenic
986099708 5:4595976-4595998 AGCCACTCCAGCTTCAGCCATGG + Intergenic
986281879 5:6330194-6330216 AGCTGCTCCAGCTCCAGCGGTGG + Intergenic
986557653 5:9027337-9027359 AGCTGCTTCAGCTCCAGCCGTGG + Intergenic
986837111 5:11651190-11651212 AGCCACTCCAGCTCTAGCCATGG + Intronic
986869255 5:12028078-12028100 AGCTGCTCCAGCTCCAGCCACGG - Intergenic
986916329 5:12625059-12625081 AGCCACTGTAGCTCAAGCTGTGG + Intergenic
986949958 5:13071045-13071067 AGCTACTCCAGCTGGAGCTGTGG - Intergenic
986975381 5:13387873-13387895 AGCTACTCCAGCTCCAGGCATGG + Intergenic
987064025 5:14270215-14270237 TGCCACTCCAGCTTCAGAGGTGG - Intronic
987169584 5:15240390-15240412 AGCCACTCCAGCTCCAGCAGTGG + Intergenic
987201735 5:15584083-15584105 AGCCACTCCAGCTCCAGCTGCGG - Intronic
987289534 5:16495520-16495542 AGTCACTCCAGCTCCAGCTATGG + Intronic
987545926 5:19310032-19310054 AGCCACTCCAGCTCCAGCGGTGG - Intergenic
987597497 5:20020534-20020556 AGCTGCTCCAGCTCCAGCCATGG + Intronic
987636236 5:20545595-20545617 AGCTGCTCTAGCTCCAGCAGTGG - Intronic
987650416 5:20733345-20733367 AGCAGCTCCAGCTCCAGCCATGG - Intergenic
987655167 5:20797198-20797220 AGCCACGCCAGCTCCAGCCATGG - Intergenic
987689215 5:21245300-21245322 GGCCATTCCAGCTCCAGCCTTGG + Intergenic
987744069 5:21947894-21947916 TGCTACTCCAGCTCCAGCCGTGG + Intronic
987802905 5:22721208-22721230 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
987909423 5:24122481-24122503 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
987918581 5:24248847-24248869 AGCCACTCCAGCTCCAACTGTGG - Intergenic
987944639 5:24588603-24588625 AGCTACTCCTTCTCCAGCTGTGG + Intronic
988016242 5:25563536-25563558 AGTCATTTGAGCTCCAGCTGTGG - Intergenic
988031691 5:25771326-25771348 AGCCACTCCAGCTTCAGCTGTGG + Intergenic
988099273 5:26657020-26657042 AGCCATTTCAGCTTCAGCTGTGG - Intergenic
988134856 5:27157945-27157967 AGCCATTCCAGCTCTAGCTGTGG + Intergenic
988159682 5:27503153-27503175 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
988227068 5:28426364-28426386 AGCCACTCCATCTCCAGCCACGG + Intergenic
988236456 5:28551233-28551255 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
988256210 5:28823222-28823244 AGCCACTCCAGCTTCAGCCTTGG + Intergenic
988262986 5:28912712-28912734 TGCTACTCCAGTTCCAGTTGTGG + Intergenic
988310345 5:29548708-29548730 AGACACTCCAGCTCCAGTCATGG - Intergenic
988353530 5:30142986-30143008 AGCTGCTTCAGCTCTAGCTGTGG - Intergenic
988448121 5:31310804-31310826 AGCCACTCCAGCCCGAGCTGTGG - Intronic
988473903 5:31565806-31565828 AGCTGCTTTAGCTCCAGCTGTGG - Intergenic
988579818 5:32459039-32459061 AGCTGCTCCAGCTCTAGCTGTGG - Intergenic
988606665 5:32684523-32684545 GGCCCCTCTGGCTCCAGCTGAGG + Intergenic
988628312 5:32900894-32900916 TGCCACTCCAGCTTCAGCTGTGG - Intergenic
988647271 5:33108354-33108376 AGCCACTCCAGCTCCAGCCATGG + Intergenic
988720100 5:33869193-33869215 AGCCACTCTAGCTCCAGCCATGG + Intronic
988720479 5:33872681-33872703 AGCCACTCCAGCTCCAGCTATGG + Intronic
988745135 5:34128121-34128143 AGCAGCTCCAGCTCCAGCCATGG + Intergenic
988768393 5:34406704-34406726 AGCCATGCCAGCTCCAGCCATGG + Intergenic
988770468 5:34427702-34427724 AGCCACTCCAGCTCCACCCATGG - Intergenic
988927838 5:36007095-36007117 AGCTGCTCCAACTCCAGTTGTGG - Intergenic
988928825 5:36015673-36015695 AGCTGCTCCAGCTCCAGCTATGG + Intergenic
989132809 5:38124429-38124451 AGCTGCTTCAGCTCCAGCAGTGG - Intergenic
989172087 5:38481982-38482004 AGTCCCTCCAGCTTCATCTGCGG + Exonic
989218321 5:38927530-38927552 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
989499474 5:42149340-42149362 AGCTGCTCCACTTCCAGCTGTGG + Intergenic
989515700 5:42340042-42340064 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
990016048 5:51063839-51063861 AGGAACTCCAACTCCAGCTAGGG + Intergenic
990136006 5:52645017-52645039 AGCCACTCCAGCTCCAGCCATGG + Intergenic
990154263 5:52856880-52856902 GGACACTCCAGCCCCAGTTGAGG - Intronic
990213739 5:53508216-53508238 AGCCGCTCCAGCTCCAGGCATGG - Intergenic
990520343 5:56573385-56573407 AGCCACTCCAGCTTGAGCCTTGG - Intronic
990649455 5:57881694-57881716 TGCGACTCCAGCTCCAGCCTGGG - Intergenic
990883778 5:60569035-60569057 AGCTGCTCCAGTTCCAGCTGTGG - Intergenic
991122521 5:63032571-63032593 AGCCACTCCAGCTTCAGCCAGGG + Intergenic
991136235 5:63185668-63185690 AGCCACTCCAGCTTCAGCTGTGG + Intergenic
991535891 5:67669132-67669154 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
991764273 5:69958031-69958053 TGCTACTCCAGCTCCAGCCGTGG + Intergenic
991783054 5:70160116-70160138 TGCTACTCCAGCTCCAGCCGTGG - Intergenic
991843505 5:70833103-70833125 TGCTACTCCAGCTCCAGCCGTGG + Intergenic
991875496 5:71160443-71160465 TGCTACTCCAGCTCCAGCCGTGG - Intergenic
992310919 5:75498489-75498511 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
992375682 5:76185640-76185662 AGCTGCTTCAGCTCCAGCTATGG - Intronic
992591530 5:78300884-78300906 AGCCACTCTAGCTCTAGCCATGG + Intergenic
992870435 5:81000008-81000030 AGCCACTCCAGCCCCAGCAGAGG - Intronic
992954178 5:81890867-81890889 AGCCACTCCAGCTCCAGCCATGG + Intergenic
993084617 5:83348498-83348520 GGCTGCTCCCGCTCCAGCTGTGG - Intronic
993253145 5:85553813-85553835 AACCACTTCAGCTCCAACTCTGG - Intergenic
993267118 5:85740299-85740321 AGCCACTCCATCTCCAGCTGTGG - Intergenic
993391011 5:87319576-87319598 AGCCACTCCAGCTCCAGCTGTGG - Intronic
993442926 5:87978614-87978636 AGCCACTCCAGCTCCAACTGTGG + Intergenic
993589581 5:89778044-89778066 AGCCTCCCCAACTCCAGCAGTGG - Intergenic
993690692 5:90996314-90996336 AGCCCTTCCAGCTCCAGCTGTGG + Intronic
993752887 5:91692183-91692205 AGCCATTCCAGTTCCAGCCATGG - Intergenic
993813276 5:92509673-92509695 AGCCACTCTAGCTCTAGCTGTGG + Intergenic
994061739 5:95486260-95486282 AGCCACTGCTGCTGGAGCTGAGG + Intronic
994400677 5:99275500-99275522 TGCTGCTCCAGCTCCAGCTCTGG + Intergenic
994439987 5:99790043-99790065 AGCCACTCCAGCTTCAGCTGTGG - Intergenic
994559269 5:101346786-101346808 AGCCTCCCCTGCTCCAGTTGCGG + Intergenic
994878918 5:105461101-105461123 AGCCACTCCAGCTCCAGCCATGG - Intergenic
995052253 5:107719754-107719776 AGCCACTGCAGCCCTGGCTGGGG - Intergenic
995340939 5:111058475-111058497 AGCCTCCCTAGCTCCAGCAGGGG + Intergenic
995390958 5:111639905-111639927 AGCCACTTCAGCTCCAGCCATGG + Intergenic
995779826 5:115763061-115763083 AGCCACTCCAGCTCCAGCCATGG - Intergenic
996027030 5:118657715-118657737 AGCCACTCCAGCTCCAGCCATGG - Intergenic
996235802 5:121127985-121128007 AGCCATTCCAGCTTCAGCCACGG + Intergenic
996897623 5:128504000-128504022 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
997088344 5:130827142-130827164 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
997091587 5:130864697-130864719 AGCCACTCCAGCTTTAGCCATGG - Intergenic
997099981 5:130958247-130958269 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
997102099 5:130980666-130980688 AGCTCCTTCAGATCCAGCTGTGG - Intergenic
997110225 5:131066564-131066586 AGTTGCTCCAGCTCCAGCTATGG + Intergenic
997159595 5:131594169-131594191 AGCTGCTCCAGCTCCATCTGGGG + Intronic
997246574 5:132355147-132355169 GGCTGTTCCAGCTCCAGCTGTGG + Intergenic
997273718 5:132564793-132564815 AGCCACTCCAGCTCCAGCCATGG + Intronic
997303483 5:132823093-132823115 AGCGACTCCGGCTCCTGCAGCGG - Exonic
997857031 5:137381651-137381673 AGCCACTCCAGCTCTGGCCATGG - Intronic
998002590 5:138636648-138636670 AGACACTTCCTCTCCAGCTGAGG - Intronic
998110520 5:139498819-139498841 TGCCACTGCAACTCCAGCTGGGG - Intergenic
998487667 5:142517253-142517275 AGTCACTCCAGCTCCAGCTATGG + Intergenic
998577124 5:143328231-143328253 TGATGCTCCAGCTCCAGCTGTGG - Intronic
998581882 5:143385137-143385159 AGCTGCTCTAGCTCCAGCTGTGG - Intronic
998745834 5:145258980-145259002 AGTCACTCCAGCTCCAGTCCAGG + Intergenic
999504437 5:152180239-152180261 AGCCACTTCAGCTCTAGTTGTGG - Intergenic
999571596 5:152925649-152925671 AGCCATTCCAGCTCTAGCCTTGG + Intergenic
999868639 5:155728315-155728337 TCCGACTCCGGCTCCAGCTGGGG - Intergenic
1000103100 5:158035537-158035559 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1000111153 5:158109283-158109305 AGCCCCTCCAGCCCCAGGGGTGG - Intergenic
1000270834 5:159681543-159681565 AGCCACTCCAACTCCAGTGGTGG - Intergenic
1000537169 5:162493466-162493488 AGCCACTCCAGTGCCAGCAGAGG + Intergenic
1000674564 5:164105316-164105338 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1000728527 5:164802052-164802074 AGCCACTCTAGCTACAGCCGTGG - Intergenic
1000784620 5:165528456-165528478 AGCTGCTTCAGCTCCAGCCGTGG + Intergenic
1000830314 5:166093931-166093953 AGCTGCTCAAGCTCCAGCTGGGG - Intergenic
1001005698 5:168047865-168047887 TGCCACTCCAGCTGCTGCTGTGG - Intronic
1001194912 5:169663692-169663714 AGCCACTCCACCTCCAGCTATGG - Intronic
1001944451 5:175767074-175767096 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1001994227 5:176142693-176142715 GGCCACTCCAGCTCCAGCCATGG + Intergenic
1002089065 5:176793825-176793847 AGCAACACTGGCTCCAGCTGAGG + Intergenic
1002688906 5:181037074-181037096 AGCCACCCAAACTGCAGCTGTGG + Intergenic
1002794053 6:456531-456553 TGCCACTCCAGTTCCAGCTGTGG - Intergenic
1003000207 6:2325077-2325099 AGCTGCTCCAGCTCCAGTTGTGG + Intergenic
1003230056 6:4243664-4243686 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1003259805 6:4506837-4506859 AGCCACTCTGGCTCCAGCCAGGG - Intergenic
1003484439 6:6563465-6563487 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1003599382 6:7503247-7503269 GGCCACTCCAGCTCCTGTTCAGG + Intergenic
1003798305 6:9630789-9630811 AGCTGTTCCAGCTCCAGCTGTGG + Intronic
1003838222 6:10093657-10093679 AGCCACTCCAACTCTAGCCATGG - Intronic
1004076882 6:12351725-12351747 AGACACTCCAGCTCCAGCCATGG - Intergenic
1004430207 6:15536420-15536442 AGCCACTCTAACTACAGCCGTGG + Intronic
1004565179 6:16789411-16789433 AGCCACTCCAGCTTCAGCCTTGG - Intergenic
1004665335 6:17744175-17744197 CTGCACTCCAGCTCCAGCTGGGG - Intergenic
1004957714 6:20748508-20748530 CTGCACTCCAGCTCCAGCTTGGG + Intronic
1005113721 6:22313854-22313876 GGCCACTCCAACTCCAGCCATGG - Intergenic
1005322882 6:24672595-24672617 AGCCACTGCAGTTCCAGCCTGGG + Intronic
1005363316 6:25053296-25053318 AGCCACTTCAGCACCAGCAGGGG + Intergenic
1005452977 6:25992056-25992078 AGCCCGCCCTGCTCCAGCTGGGG - Intergenic
1005543258 6:26835875-26835897 AGCAGCTCCAGCTCCAGCCATGG + Intergenic
1005871268 6:29975732-29975754 AGCCGCTCCCGCTCTAGCCGAGG + Intergenic
1005982972 6:30851626-30851648 AGCTACTTTAGCTCCAGCTGTGG + Intergenic
1006364028 6:33604296-33604318 AGCTGCTCCATGTCCAGCTGTGG - Intergenic
1006712137 6:36083504-36083526 AGTCTCTCCAGCACCAGCAGGGG - Intronic
1006894050 6:37454919-37454941 AGCCACTCCCTCTTCTGCTGGGG - Intronic
1007238902 6:40411186-40411208 TCCCTCTCCTGCTCCAGCTGGGG + Intronic
1007361519 6:41360144-41360166 GGCCACTCCAGCTCCAGCCTTGG + Intergenic
1007633209 6:43283993-43284015 AGCCGCGCCAGGTCCTGCTGCGG - Exonic
1008848217 6:55993799-55993821 AGCTTCCCCAGCTCCAGCTGTGG - Intergenic
1008998780 6:57689105-57689127 GGCTGCTCCAGTTCCAGCTGTGG - Intergenic
1009014084 6:57878040-57878062 AGCAGCTCCAGCTCCAGCCATGG + Intergenic
1009187264 6:60588484-60588506 GGCTGCTCCAGTTCCAGCTGTGG - Intergenic
1009345573 6:62609998-62610020 AGTTGCTCCAGCTCCAGCTGTGG - Intergenic
1009550749 6:65088875-65088897 AGCTGCTTCAGCTCCAGCTATGG + Intronic
1009607804 6:65896451-65896473 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1009763568 6:68039107-68039129 AGCCACTCCAGCTCCAGCCGTGG - Intergenic
1009791232 6:68403805-68403827 AGCCACTCCAGCTCCAGTCATGG - Intergenic
1010268233 6:73891603-73891625 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1010299389 6:74242962-74242984 TGTCACTCCAACTCCATCTGTGG - Intergenic
1010411482 6:75566768-75566790 AGAAACTCCAGCTCCAGCTGTGG - Intergenic
1010590613 6:77707761-77707783 TGCTACTACAGCTCCACCTGTGG + Intronic
1010611008 6:77953793-77953815 AGCCACTCCAGTTCTAGCCATGG + Intergenic
1010630500 6:78192092-78192114 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1010651045 6:78455740-78455762 AGCTTCTTCAGCTCCAGCTGTGG - Intergenic
1010659802 6:78556471-78556493 AGCCACTCCAGAGCCAGCCATGG - Intergenic
1010819407 6:80395856-80395878 AGCTGCTTCAGCTCCAGCTCTGG + Intergenic
1010860196 6:80900477-80900499 AGCTGCTCCAGCTTCAGCTGTGG - Intergenic
1010978351 6:82341462-82341484 AGCTGCTCCAGCACCAGCTGTGG - Intergenic
1011245579 6:85318075-85318097 AGCTGCTCCAGCTCCAACTGTGG + Intergenic
1011287914 6:85744721-85744743 AGCTGCTCCTGCTCCAGCTGTGG + Intergenic
1011294106 6:85808352-85808374 AGCTTCTCCAGCTCCAGCCATGG - Intergenic
1011345788 6:86368667-86368689 AGCTATTCCAGCTGCAGCTGTGG + Intergenic
1011348761 6:86399942-86399964 AGACATTCCAGCTCCAGCTACGG - Intergenic
1011555789 6:88570314-88570336 GGCCTCTCCAGCTCCAGCTGTGG - Intergenic
1011714025 6:90085460-90085482 AGCCACCCATGCTCCAGCAGTGG - Intronic
1011955961 6:93025712-93025734 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1012039399 6:94185192-94185214 AGTCACTCCAGCTCCAGCTCTGG - Intergenic
1012064904 6:94537675-94537697 AGCTGCTTCAGCTCCAGCCGTGG - Intergenic
1012125295 6:95420881-95420903 AGCTGTTCCAGCTCCAGCTTTGG - Intergenic
1012210198 6:96509812-96509834 AGCCACTCCAGCTCCAGTCATGG + Intergenic
1012485876 6:99722312-99722334 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1012597373 6:101055577-101055599 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1012617387 6:101293553-101293575 AGCTAATCCAGCTCCAGCCATGG - Intergenic
1012663969 6:101943098-101943120 AGCCACTCCAGCTCCAGCCATGG + Intronic
1012767446 6:103386771-103386793 AGCCACTGCAGCTCTAGCTTTGG + Intergenic
1012780109 6:103546880-103546902 AGCCACTCTAGCTCCAGCCATGG - Intergenic
1012823835 6:104123552-104123574 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1012829385 6:104186533-104186555 GGCCACTCCAGCACCAGCAGAGG - Intergenic
1012940480 6:105409846-105409868 GGCCACTTCAGCTGCAGCTTTGG - Intergenic
1013716423 6:112968087-112968109 AACCACTCCAGCTCCAGCCGTGG - Intergenic
1013925244 6:115464212-115464234 AGCTGCTTCAGCTCTAGCTGTGG + Intergenic
1013970829 6:116016232-116016254 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
1014042941 6:116850664-116850686 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1014320568 6:119923919-119923941 AGCCACTACTGCTGCAGTTGGGG - Intergenic
1014450062 6:121572123-121572145 GGCCACTCCAGCTCCAGCTGTGG + Intergenic
1014895188 6:126892693-126892715 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1014933758 6:127363749-127363771 AGCCACTCCAACTCCAGCTGTGG + Intergenic
1015178602 6:130338138-130338160 AGCTGCTCCAGCTCCAGCTGGGG + Intronic
1015239585 6:131008216-131008238 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
1015252552 6:131142377-131142399 AGTTTCTCCACCTCCAGCTGTGG + Intronic
1015347300 6:132175045-132175067 AGCCACTCCAGCACTAGCTGTGG - Intergenic
1015358180 6:132305170-132305192 AGCCTCTCTGGCTCCAGCAGGGG - Intronic
1015652487 6:135478892-135478914 AGCTGCTCTGGCTCCAGCTGTGG + Intronic
1016020720 6:139234465-139234487 AGCTGCTCCAGCTCCAGCAGTGG + Intergenic
1016128305 6:140433997-140434019 AGCCATTCCAGCTCCAGCTGTGG + Intergenic
1016200122 6:141395795-141395817 AGACACGCCAGCTGCTGCTGCGG - Intergenic
1016284987 6:142462887-142462909 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1016295968 6:142574013-142574035 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1016568892 6:145491249-145491271 GGCCACTTCGGCACCAGCTGAGG + Intergenic
1016613725 6:146023972-146023994 ATTTGCTCCAGCTCCAGCTGTGG + Intergenic
1017516551 6:155161226-155161248 TGCCACTGCATCCCCAGCTGGGG - Intronic
1017766224 6:157609413-157609435 GGCCACTCCAGGAACAGCTGAGG + Intronic
1017995841 6:159531139-159531161 CGTCACTCCAGCACCTGCTGTGG + Intergenic
1018155686 6:160983375-160983397 AGTCATTCCAGCTCCAGCCATGG + Intergenic
1018358236 6:163040134-163040156 AGCTACTTCAGCTCCGGCTGTGG + Intronic
1018527452 6:164728803-164728825 ACCTGCTTCAGCTCCAGCTGTGG + Intergenic
1018592663 6:165443762-165443784 AGTCACTTCAGCTCTAGCCGTGG - Intronic
1019155495 6:170036085-170036107 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1019191944 6:170256621-170256643 AGCCACTTCAGCACAGGCTGAGG - Intergenic
1019219585 6:170463412-170463434 AGTCCCTCCAGGTCCAGCTCAGG - Intergenic
1019382403 7:730866-730888 ACCCACGCCAGCTCCAGGAGGGG - Intronic
1020349944 7:7208610-7208632 AGCCCCTCCCCCTCTAGCTGAGG - Intronic
1020525248 7:9251122-9251144 AGCCTCTCTGGCTCCAGCAGGGG - Intergenic
1020696513 7:11420351-11420373 AGTCTCTCCAGCTCCAGCCATGG + Intronic
1020810725 7:12846850-12846872 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1021355543 7:19650416-19650438 AGTGGCTCCAGCTCCAGCTATGG + Intergenic
1021561529 7:21972564-21972586 AGCCACCCAAACTGCAGCTGTGG - Intergenic
1021617677 7:22519830-22519852 AGCCACTCCAGCTCCAGCTGTGG + Intronic
1022394021 7:29969629-29969651 AGCCAGTCCAGGAGCAGCTGGGG - Intronic
1022512575 7:30949991-30950013 AGCCACTCTGACTCCAGCTGAGG + Intronic
1022784740 7:33627168-33627190 AGCCATTCCAGCCCCAGCTGTGG + Intergenic
1022927271 7:35069320-35069342 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1023188570 7:37555602-37555624 AGCCACTCCAGCTCCAGCTATGG - Intergenic
1023275655 7:38516349-38516371 AGCCACTCCAGCTCCAGTCATGG + Intronic
1023347815 7:39289241-39289263 GGCCACTCCAGCCCCAGCACTGG + Intronic
1023391377 7:39714704-39714726 GGCCATTCCAGCTCCAGCCAGGG + Intergenic
1023406874 7:39843026-39843048 AGCCACTCCAGCTCCAGCTATGG + Intergenic
1023484870 7:40675577-40675599 GGCCACTTAAGCTACAGCTGGGG + Intronic
1023690271 7:42779191-42779213 AGCCACTCCAGCTACAGCCATGG + Intergenic
1023788999 7:43737311-43737333 AGCCACCCAAACTGCAGCTGTGG + Intergenic
1023966894 7:44967454-44967476 AGCCACATCTGCTCCAGCAGTGG - Intronic
1024083997 7:45878590-45878612 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1024373338 7:48610809-48610831 AGCTGCTCCAGCTCCAGCCATGG - Intronic
1024487149 7:49931892-49931914 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
1024845438 7:53636580-53636602 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1024865841 7:53904436-53904458 AGCTGCTTCAGCTCCAGCTATGG - Intergenic
1025178181 7:56812344-56812366 AGCCTCTCCAGGCCCAGCTCCGG - Intergenic
1025179051 7:56815876-56815898 AGCCTCTCCAGGCCCAGCTCCGG - Intergenic
1025179506 7:56817762-56817784 AGCCTCTCCAGGCCCAGCTCCGG - Intergenic
1025179956 7:56819600-56819622 AGCCTCTCCAGGCCCAGCTCCGG - Intergenic
1025181301 7:56825171-56825193 AGCCTCTCCAGGCCCAGCTCCGG - Intronic
1025181747 7:56827009-56827031 AGCCTCTCCAGGCCCAGCTCCGG - Intronic
1025221635 7:57115266-57115288 AGCTGCTCCAGATCCAGCTGTGG - Intergenic
1025267337 7:57474523-57474545 AGCTGCTCCACATCCAGCTGTGG + Intergenic
1025632417 7:63286934-63286956 AGCTGCTCCAGATCCAGCTGTGG - Intergenic
1025650144 7:63459296-63459318 AGCTGCTCCAGATCCAACTGTGG + Intergenic
1025690170 7:63749986-63750008 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025690617 7:63751809-63751831 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025691068 7:63753632-63753654 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025691502 7:63755408-63755430 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025691942 7:63757231-63757253 AGCCTCTCCAGGCCCAGCTCCGG + Exonic
1025692391 7:63759054-63759076 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025692835 7:63760877-63760899 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025693251 7:63762556-63762578 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025693694 7:63764379-63764401 AGCCTCTCCAGGCCCAGCTCCGG + Intergenic
1025721553 7:64020388-64020410 AGCTGCTCCAGATCCAGCTGTGG + Intergenic
1025743577 7:64223188-64223210 AGCTGCTCCAGATCCAGCTGTGG + Intronic
1025748705 7:64271616-64271638 AGCTGCTCCAGATCCAGCTGTGG + Intergenic
1025954746 7:66174138-66174160 CTGCACTCCAGCTCCAGCTTGGG + Intergenic
1026292341 7:69018924-69018946 AGCTGCTCCAGCTGTAGCTGCGG - Intergenic
1026564910 7:71481714-71481736 AGCCACACAAAGTCCAGCTGTGG - Intronic
1026631249 7:72039942-72039964 AGCAGCTCCAGCTCCAGCCCAGG + Intronic
1027341171 7:77209857-77209879 AGCTGCTCCAGCTCCAGCCATGG - Intronic
1027395315 7:77747475-77747497 AGCCATCCCAGCTCCAGCTGTGG + Intronic
1027506349 7:79020975-79020997 AGCTGCTTCAGCTCCAGCTGTGG + Intronic
1027604502 7:80283973-80283995 AGCAGCTCCAGCTCCAGCCATGG + Intergenic
1027666455 7:81047126-81047148 GGCCACTCCAGCTCCAGCCATGG + Intergenic
1027831499 7:83183023-83183045 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1027959046 7:84919985-84920007 AACCACTCCAGCTCCAACCATGG - Intergenic
1028134449 7:87210983-87211005 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
1028207213 7:88031831-88031853 AGCCACTCCAGCTCCAGCTGTGG + Intronic
1028374997 7:90136274-90136296 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1028378997 7:90176935-90176957 AGCCACCCAAGCCACAGCTGTGG - Intronic
1028438334 7:90830369-90830391 GGCCATTCCAGCTCCAGCCATGG - Intronic
1028493633 7:91441064-91441086 AGCTACTTCAGCTTTAGCTGTGG + Intergenic
1029425197 7:100490203-100490225 AGCCCCTCCATCTCCAGATAGGG - Intronic
1030149339 7:106387134-106387156 AGACACACCAGCTGCTGCTGTGG - Intergenic
1030357342 7:108557066-108557088 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
1030722406 7:112885107-112885129 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
1030834539 7:114265879-114265901 GGCCACTCAAGCTCCAGCCTCGG - Intronic
1031193886 7:118588487-118588509 GGCTGCTCCAGCTTCAGCTGTGG - Intergenic
1031242690 7:119266476-119266498 AGCCACTCTATCTCCAGCCATGG - Intergenic
1031360697 7:120845130-120845152 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
1031396943 7:121285195-121285217 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
1031435634 7:121728791-121728813 AGCTACTCCGTCTCCAGCTGTGG - Intergenic
1031478136 7:122247680-122247702 AGTCACTCCAGCTCCAGCCATGG + Intergenic
1031583490 7:123505607-123505629 AGCTACTCCAGCTCCTGCTCTGG - Intronic
1031671469 7:124552440-124552462 TGCCTCTCCAGCATCAGCTGTGG + Intergenic
1031725336 7:125230609-125230631 AGTCACTCCAGCTCCAGCCACGG - Intergenic
1031795979 7:126175185-126175207 AACCACTGCAGCTCCAGCCATGG + Intergenic
1031872506 7:127102525-127102547 AGCCACTCTAGCTCTAGCCTTGG + Intronic
1031914140 7:127546454-127546476 AGATGCTCCAGCTCCAGATGTGG - Intergenic
1032346320 7:131119776-131119798 AGCCACTCCAGCTCCAGCCATGG - Intronic
1032560962 7:132892721-132892743 AGCAGCTCCAGCTCTAGCCGTGG + Intronic
1032794570 7:135267474-135267496 ATCCTCTCCTGCTGCAGCTGAGG - Intergenic
1033063472 7:138129660-138129682 AGTCACTCCAGCTCCAGCCGTGG - Intergenic
1033104981 7:138512626-138512648 AGCCTCTCCAGTTCCAGCCATGG - Intronic
1033542281 7:142368011-142368033 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1033620423 7:143057649-143057671 AGCCACTCCAGCTCCAGTCATGG - Intergenic
1033910684 7:146260034-146260056 AGCCACTCTAGCTTTTGCTGTGG + Intronic
1034365206 7:150540297-150540319 GGCTACTCCAACTCCAGCTGCGG - Intergenic
1034502029 7:151456843-151456865 TGGCACCCCAGCTCCAGCTTTGG - Intergenic
1034573026 7:151972620-151972642 AGCCACTCCAGCTCCAGCCATGG + Intronic
1034689315 7:153001123-153001145 AGTCACTCCAGTTCCAGCCATGG - Intergenic
1034710401 7:153185986-153186008 GGCCACTGCAGCTCCAGCCATGG - Intergenic
1034751298 7:153571420-153571442 AGGTGCTTCAGCTCCAGCTGTGG + Intergenic
1034904826 7:154934669-154934691 AGCTGCTTCAGCTCTAGCTGCGG - Intronic
1035120764 7:156564690-156564712 AGTCACTCCAGCTCCAGCTGTGG - Intergenic
1035128584 7:156629870-156629892 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1035180302 7:157084633-157084655 AAAAACTCCAGCTCCAGCTGTGG + Intergenic
1035547892 8:497840-497862 AGCCGCTCCACCTCCCGCAGTGG + Intronic
1035989837 8:4477248-4477270 AGCCACTGCAGCTCCCACTAAGG + Intronic
1036206340 8:6808085-6808107 AGCCACTGAAGCTCCAGGTCAGG + Intergenic
1036277532 8:7368792-7368814 AGCCACTCCAGCTCCAGCCATGG + Intronic
1036723689 8:11200960-11200982 AGCCACGGCCGCTCCACCTGCGG + Exonic
1036914719 8:12793819-12793841 ACCTACTCCAGCTCCAGCCATGG - Intergenic
1037415797 8:18648809-18648831 AGCCACTCTAGCTACAGCTGTGG + Intronic
1038684293 8:29702386-29702408 TGTCACTCTAGCTCCAGCAGTGG + Intergenic
1038840776 8:31182933-31182955 TGCCACTGCAACTCCAGCTTGGG - Intergenic
1039082351 8:33745479-33745501 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1039159003 8:34595906-34595928 AGCCACTCTGGCTCCAGCCTTGG - Intergenic
1040085668 8:43337854-43337876 AGCCACTACAGGTCCAACTGTGG + Intergenic
1040401178 8:47051441-47051463 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1040407029 8:47115526-47115548 AGCTGCTACAGGTCCAGCTGTGG - Intergenic
1040530849 8:48265377-48265399 GGCCTCTCCAGGGCCAGCTGAGG - Intergenic
1040644986 8:49387862-49387884 AGGTGCTTCAGCTCCAGCTGTGG + Intergenic
1040763088 8:50874311-50874333 AGCCTTCCCAGCTCCAGCAGTGG - Intergenic
1040890936 8:52314981-52315003 AGCCACACCATCTCCAGTGGGGG - Intronic
1040945925 8:52883885-52883907 GGTCACTCCAGCTCTAGCTGTGG - Intergenic
1041392517 8:57359590-57359612 GGGCACTCCAGCTCCAGCCGTGG + Intergenic
1041632100 8:60099747-60099769 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1041940446 8:63381770-63381792 AGCCACTCCAGCTGCAGCAATGG + Intergenic
1042071647 8:64941572-64941594 AGGCACTCCAGGTCCAGTTGTGG - Intergenic
1042161823 8:65904628-65904650 AGCCACTCTAGCTCCAGCTGTGG + Intergenic
1042181087 8:66088242-66088264 AGCCACTCCAGCTCCAGATGAGG - Intronic
1042424611 8:68632720-68632742 AGCCACTCCAGCTCCAGCCGTGG + Intronic
1042605437 8:70541431-70541453 AGCTGCTCCTGCTCCAGCTGTGG + Intergenic
1042827156 8:72991032-72991054 AGTCACTCCAGCTCCAGCCGTGG + Intergenic
1043065749 8:75568016-75568038 ATCCACTCCAGCTCCAGCCATGG - Intergenic
1043201230 8:77372370-77372392 AGCCACTCCAACTCCAGCTATGG + Intergenic
1043214604 8:77569911-77569933 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1043370313 8:79583777-79583799 AGCTGCTTCAGCTCCAGCTCTGG + Intergenic
1043384252 8:79732405-79732427 AGCCACTCCAGCTCCAGCTGGGG - Intergenic
1043571113 8:81603279-81603301 AGCCACACCATCTACAGATGTGG + Intergenic
1043776658 8:84278279-84278301 AGACTCTTCAGCTCTAGCTGTGG - Intronic
1043940467 8:86190355-86190377 AGCTACTTCAACTCCAGCTGTGG - Intergenic
1044295106 8:90518652-90518674 AGCCACTCTGTTTCCAGCTGTGG + Intergenic
1044326892 8:90869023-90869045 AGCTGCTCCAGCTCCAGCCACGG + Intronic
1044395682 8:91708237-91708259 AGCTACTTCAGCTCCAGCTGTGG + Intergenic
1044504691 8:93004352-93004374 AGCCACTCCAGATCCAGCTGTGG - Intronic
1044638032 8:94347058-94347080 AGCCCCTCCCCCTCCAGCTGAGG + Intergenic
1044775059 8:95678661-95678683 AACCACTCAAGCCACAGCTGCGG - Intergenic
1044879852 8:96712630-96712652 AGCTGCTTCAGCTCCAGCTATGG - Intronic
1045258037 8:100546352-100546374 AGCCACTCCGGCTCCAGCCATGG + Intronic
1045784316 8:105902850-105902872 AGCCACTCCAGCTTCAGCCTTGG - Intergenic
1045791313 8:105987929-105987951 GGCCACTCCAGGTCCAGCCATGG + Intergenic
1045993732 8:108339388-108339410 AACCACTCCAGCTCCAGTCATGG - Intronic
1046134064 8:110003891-110003913 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1046134660 8:110010952-110010974 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1046267235 8:111846673-111846695 AGCCACTCCATCTTTAGTTGTGG - Intergenic
1046668868 8:117035873-117035895 AGCTGCTCCAGCTCCAGCTGTGG - Intronic
1046689607 8:117267820-117267842 AGCTGCTCCAGCTGTAGCTGTGG - Intergenic
1046888933 8:119400406-119400428 ACCCACTCCAGCTCCAGCTGTGG + Intergenic
1046917380 8:119691991-119692013 AGCTGTTTCAGCTCCAGCTGTGG + Intergenic
1046924106 8:119768055-119768077 AGCCTCCCTTGCTCCAGCTGAGG + Intronic
1047917912 8:129603019-129603041 AGCTGCTTCACCTCCAGCTGTGG - Intergenic
1047923405 8:129657896-129657918 AGCTGCTCCTGTTCCAGCTGTGG - Intergenic
1047946633 8:129887212-129887234 AGCCACTCCAGCTCCAGCCACGG + Intronic
1048043345 8:130751292-130751314 AGTCACTCCAGTTCCAGCCATGG - Intergenic
1048137389 8:131759633-131759655 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1048213419 8:132475997-132476019 AGCCGCTCCAGTTCCAGCCATGG + Intronic
1048280411 8:133101531-133101553 AGCCCCTCCTGCCCCATCTGGGG + Intronic
1048516147 8:135113513-135113535 GGCTACTCCAGCTCCAGATGTGG + Intergenic
1048526228 8:135205598-135205620 AGCTGCTCCACTTCCAGCTGTGG + Intergenic
1048839340 8:138551326-138551348 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1049214588 8:141401939-141401961 GGCCACTCCAGCTTCAGCCCAGG + Intronic
1049252945 8:141598882-141598904 GGCCATGCCAGCTCCAGCTGTGG + Intergenic
1049589304 8:143449017-143449039 AGCCAGTCCAGCTCCAGCTGTGG - Intronic
1050402442 9:5270709-5270731 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1050412488 9:5381356-5381378 AGCTGCTCCAGCTCCAGCTGTGG + Intronic
1050618317 9:7426404-7426426 AGCCTCTCTGGCTCCAGCAGGGG + Intergenic
1050674552 9:8037018-8037040 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1050904549 9:10987172-10987194 AGCCACTCTACCTCCAGCCATGG - Intergenic
1050907840 9:11027463-11027485 GGCCACTCCAGCTCCAGCCTTGG - Intergenic
1050935167 9:11386953-11386975 AACCACCCCAGTTCCAGCTGTGG + Intergenic
1050939308 9:11439502-11439524 AGCCACTCCAGCTCCAGCCACGG + Intergenic
1050976852 9:11949740-11949762 AGCCACTCCAGCTTCAGCCATGG - Intergenic
1050996889 9:12231939-12231961 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1051127539 9:13821445-13821467 TGCCACTCCAGGTCCAGCCATGG + Intergenic
1051574103 9:18595375-18595397 AGCCTCTCCTGCTGCAGTTGAGG - Intronic
1051582742 9:18695057-18695079 AGCTGCTCCAGCTCCAGCCATGG - Intronic
1051655095 9:19372816-19372838 CGCCACTGCAACTCCAGCTTGGG + Exonic
1051767476 9:20540555-20540577 ACCCACTTCAGCTCCAGCCATGG - Intronic
1051919810 9:22251570-22251592 AGCCACTTCAGCTCCAGCGATGG - Intergenic
1051925192 9:22316892-22316914 AGCAGCTCCAGCTCCAGCTGTGG + Intergenic
1052090478 9:24320917-24320939 CACTGCTCCAGCTCCAGCTGTGG - Intergenic
1052168072 9:25357857-25357879 AGCCACTCCAGCTCCAGCCATGG - Intergenic
1052173842 9:25432957-25432979 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1052179396 9:25505713-25505735 AGCCACTCCACCTCCAGCTGTGG - Intergenic
1052208329 9:25870255-25870277 AGCTACTCCAGCTCTAGCCATGG - Intergenic
1052382713 9:27789083-27789105 AGCTGCTCTAGCTCCAGCTGTGG + Intergenic
1052522198 9:29562791-29562813 AGCCATTTCAGCTCCAGCCTTGG + Intergenic
1052686657 9:31765340-31765362 AGCTATTCTGGCTCCAGCTGTGG - Intergenic
1052702200 9:31950833-31950855 AGCTGCTTCAGCTCCAGCCGTGG - Intergenic
1052896623 9:33753113-33753135 AACCACTCCAGAGGCAGCTGTGG - Intronic
1053000966 9:34577248-34577270 TGCCACTCCAGGTGTAGCTGGGG + Intronic
1053076478 9:35138787-35138809 AGCCACCCAAACTGCAGCTGTGG + Intergenic
1053264273 9:36699097-36699119 AGCCACTCCAGTTCCAGCCATGG - Intergenic
1053619243 9:39798999-39799021 AGCCACCCAAGCTGCAGCTGTGG - Intergenic
1053619629 9:39802288-39802310 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1053877399 9:42558348-42558370 AGCCACCCAAGCTGCAGCTGTGG - Intergenic
1053877799 9:42561604-42561626 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1053894856 9:42732762-42732784 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1053895263 9:42736340-42736362 AGCCACTCAAGCTGCAGCTGTGG + Intergenic
1054233894 9:62540090-62540112 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1054234296 9:62543374-62543396 AGCCACCCAAGCTGCAGCTGTGG + Intergenic
1054264529 9:62905155-62905177 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1054264914 9:62908430-62908452 AGCCACCCAAGCTGCAGCTGTGG + Intergenic
1055223804 9:73969926-73969948 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1055337446 9:75247222-75247244 AGCCTCTTCAGCTCCAGCCATGG + Intergenic
1055698626 9:78917152-78917174 AGCCACTCCAGCTCCAACTGTGG + Intergenic
1055774391 9:79752163-79752185 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1055848316 9:80594340-80594362 AGCTGCTTCACCTCCAGCTGTGG + Intergenic
1056021258 9:82440683-82440705 TGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1056055787 9:82822199-82822221 AGACACATCAGCTTCAGCTGAGG - Intergenic
1056527339 9:87455530-87455552 AGCTACTCCAGCTCCAGCTGTGG - Intergenic
1056625747 9:88251865-88251887 AGCCACTCCAGCTCCAGCTATGG + Intergenic
1056676798 9:88682858-88682880 AGCCACTCCAGCACCAAATGAGG + Intergenic
1057332486 9:94128852-94128874 AGCCACTCCAACTCCAACCATGG + Intergenic
1057983128 9:99682044-99682066 AGCCACTCTAGCTCCAGCCATGG - Intergenic
1058288588 9:103210122-103210144 AGCTACTCCAGCTCCAGCTGTGG - Intergenic
1058323061 9:103658407-103658429 AGCCACTCCAGTTCCAGTCCTGG + Intergenic
1058385331 9:104429305-104429327 AGCCACTCCAGCTCCAGCCATGG + Intergenic
1058722086 9:107773356-107773378 AGCCACTCCAGTTGCTGCTATGG - Intergenic
1058813047 9:108659686-108659708 AGCTACTCCAGCACCAGCTGTGG + Intergenic
1059023061 9:110597160-110597182 AGCTACTCCAGCTCTAGCCATGG - Intergenic
1059110805 9:111556910-111556932 GGCCACTCCAGCTCCAGCCACGG - Intronic
1059509959 9:114836040-114836062 AGGCACTCCAGCTCCAGCCAGGG - Intergenic
1059581755 9:115556558-115556580 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1059604981 9:115824769-115824791 AGCCACTCCAGCTTCAACTTTGG + Intergenic
1059617583 9:115967609-115967631 AATCACTCCAGCTCCAGCTGTGG - Intergenic
1059776986 9:117485752-117485774 AGCCAATCCAGCTGAAGCAGAGG - Intergenic
1059917279 9:119117816-119117838 AGCCACTCCAGGTCCAGCCTTGG + Intergenic
1060019557 9:120117386-120117408 GGCCTCTCCACCTCCAGCTGTGG + Intergenic
1060334248 9:122706380-122706402 AGCCACTCCAGCTCCAGTCATGG - Intergenic
1060401634 9:123353121-123353143 AGTGACTGCAGCTCCAGCTGAGG - Intergenic
1060482111 9:124022764-124022786 CGCAACTGCAGCTGCAGCTGCGG + Intronic
1060939559 9:127535673-127535695 AGCGACTCCAGCCCCACCTGGGG - Intronic
1060973839 9:127753820-127753842 CGTCCCTCTAGCTCCAGCTGTGG - Intronic
1061421752 9:130476597-130476619 AGCTATTCTACCTCCAGCTGTGG + Intronic
1061629744 9:131864697-131864719 AGCCTCTCCAGCTGCAGGTGTGG - Intronic
1061662857 9:132141771-132141793 CTCCACGGCAGCTCCAGCTGGGG + Intergenic
1061891845 9:133625840-133625862 CGCTGCTCCAGTTCCAGCTGTGG - Intergenic
1061907914 9:133708260-133708282 CGCCCCTACAGCTCCTGCTGGGG - Intronic
1062359121 9:136179082-136179104 AACCTCTTCAGCTGCAGCTGGGG + Intergenic
1062406556 9:136399650-136399672 GGTCCCTCCAGCCCCAGCTGCGG + Intergenic
1062438758 9:136559566-136559588 AGCCACTCTAGCTCCAGCCATGG + Intergenic
1062670035 9:137703099-137703121 AGCCACTCCAGCTCCAGTGGTGG - Intronic
1062685700 9:137811983-137812005 AGCAACTCCAGCCCTGGCTGTGG - Intronic
1186169534 X:6862080-6862102 AGTCACTTAAGCTCCATCTGTGG - Intergenic
1186275883 X:7938249-7938271 AGCCTCTCAAGATCCTGCTGGGG - Intergenic
1186372896 X:8965463-8965485 AGCTGCTCCATCTCCAGCTGTGG - Intergenic
1186620459 X:11235306-11235328 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
1186770726 X:12815579-12815601 AGCCACTCAAACTCCAGGTAAGG - Intronic
1187603738 X:20861357-20861379 GGCAGCACCAGCTCCAGCTGTGG + Intergenic
1187650000 X:21391513-21391535 AGCCACTCCAGCTCCAGCTGCGG - Intronic
1187734371 X:22289468-22289490 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1187940795 X:24379029-24379051 AGCTACTCCAGCTGAGGCTGAGG - Intergenic
1188062511 X:25618356-25618378 AGCCACTCAAGCTCCAGTTGTGG - Intergenic
1188070823 X:25716022-25716044 ACCCACTTCAGACCCAGCTGTGG - Intergenic
1188105636 X:26144213-26144235 GACCACTCCAGCACCAGCTGTGG - Intergenic
1188221527 X:27546742-27546764 AGCCACTTCAGCTCCAGTAGTGG - Intergenic
1188305790 X:28558566-28558588 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1188651105 X:32632696-32632718 GGCCACTGTAGCTCCAGCTGTGG - Intronic
1188807863 X:34613902-34613924 AGCCACTACAGCTCCAGCTGTGG - Intergenic
1188833423 X:34928553-34928575 AGCTACTCCATCTCCAGCTGTGG - Intergenic
1188925960 X:36044083-36044105 AGACGCTCCAGCTCTAGCTGTGG - Intronic
1189017109 X:37295860-37295882 GGTCACTCCAGCTCCAGCCATGG - Intergenic
1189035135 X:37487869-37487891 AGCTGATCCAGCTCCAGCTGCGG - Intronic
1189431425 X:40950653-40950675 AACCACTCCAGATCCAGCCTTGG - Intergenic
1189553115 X:42113695-42113717 AGCCACTCCAGCTCCAGCCTTGG - Intergenic
1189886058 X:45545998-45546020 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1190064880 X:47233058-47233080 AGCAAATCCAGCTGCTGCTGCGG + Exonic
1190466132 X:50726570-50726592 AGCCACTCCAGCTCCAGCCATGG + Intronic
1190756389 X:53405455-53405477 AGCCTGTCCAGCTCCAGCCTGGG + Intronic
1190772452 X:53526693-53526715 AGCCTCTCCAGCTCCAGCTGTGG + Intergenic
1190950591 X:55139579-55139601 AGCTACTCCAGCTCCAGTTGTGG + Intronic
1191089924 X:56608948-56608970 AGCCACTCCAGCTTCAGCTGTGG - Intergenic
1191226011 X:58043868-58043890 AGCCACTCCATCTCCAGGTGTGG - Intergenic
1191677719 X:63809281-63809303 TGCATCTCCAGCTCCAGCAGTGG + Intergenic
1191734725 X:64376941-64376963 AGCCACTCCAGCTCCAGCCATGG + Intronic
1191738025 X:64407608-64407630 GGCCACTCCTGCTCCAGCTGTGG - Intergenic
1191873317 X:65769004-65769026 AGTCACTCCAGCTCCAGTTGTGG + Intergenic
1191923240 X:66279452-66279474 AGCCACTCTAGTTCCAGCTGTGG - Intergenic
1191925686 X:66307322-66307344 AGCTACTCCAGCTGAGGCTGAGG - Intergenic
1192131911 X:68559515-68559537 AGCCACTCCAGCTCTAGTCATGG - Intergenic
1192696075 X:73417196-73417218 GGCCAATCCAGTTCCAGCTATGG - Intergenic
1192923206 X:75729494-75729516 AGCCATTCCAGCTCCAGCTATGG - Intergenic
1192930267 X:75799325-75799347 AGCCTCTCTGGCTCCAGCAGGGG + Intergenic
1193026351 X:76849963-76849985 AGCCAATCCAGATCCAGCCATGG - Intergenic
1193039297 X:76987644-76987666 AGCCCCTCTGGCTCCAGCAGGGG - Intergenic
1193043156 X:77024773-77024795 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1193050643 X:77096053-77096075 AGCCACTCCAGCTACAGTTATGG + Intergenic
1193236651 X:79114700-79114722 AGCCACTCCAGTTCCAGCCATGG - Intergenic
1193246573 X:79237111-79237133 AGCTGTTTCAGCTCCAGCTGTGG - Intergenic
1193256461 X:79354872-79354894 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1193332925 X:80255963-80255985 AGACACTCCAGCTCTAGCCATGG + Intergenic
1193365178 X:80623250-80623272 AGTCTCCCCAGCTCCAGCAGGGG + Intergenic
1193387330 X:80886612-80886634 AGCTGCTTCAGTTCCAGCTGTGG - Intergenic
1193421850 X:81292377-81292399 AGCCACTCCAGCTACAACCATGG - Intronic
1193442905 X:81565128-81565150 GGCCACTCAAACTCCAGCTGTGG + Intergenic
1193466464 X:81853322-81853344 AGCTGCTCCAGCTGCAGCTGTGG - Intergenic
1193492025 X:82162139-82162161 AGCTGCTCCAGCTTCAGCTGTGG + Intergenic
1193506250 X:82348224-82348246 AGCTGCTTCAGCTCCAGCTATGG - Intergenic
1193627361 X:83837608-83837630 AGCTACTCCAGCTCCAGCCAAGG - Intergenic
1193724834 X:85026226-85026248 AGCCACTCTAGCTCCAGCCATGG - Intronic
1193740814 X:85215187-85215209 CACCACTTCGGCTCCAGCTGTGG - Intergenic
1193795271 X:85866238-85866260 AGCTGCTCCAGCTCCAGCCATGG + Intronic
1193850473 X:86531453-86531475 TGCCACTCCAGTTCCAGCCATGG + Intronic
1193911292 X:87309659-87309681 AGCCACTCCAACTCCAGCCATGG - Intergenic
1193948220 X:87764395-87764417 AGCCACTCCACCTCCAGCTCTGG - Intergenic
1194038878 X:88915325-88915347 AGCCACTCCAGCTCCAGCTGTGG - Intergenic
1194053839 X:89105329-89105351 AGCCACTGCAGCTCTAGCTGTGG - Intergenic
1194064160 X:89241482-89241504 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1194134994 X:90130414-90130436 AGTAGCTTCAGCTCCAGCTGTGG + Intergenic
1194149830 X:90310037-90310059 AACCACTCCAGCTCCAGCTGTGG - Intergenic
1194150841 X:90323596-90323618 AGCCACTTAAACTCTAGCTGTGG - Intergenic
1194178884 X:90688662-90688684 AGCCACTCTATCTCCAGCCATGG - Intergenic
1194192763 X:90857761-90857783 AGTTATTCCAGCTCCAGCTCTGG + Intergenic
1194206313 X:91015546-91015568 AGCCTTTCCAGCTCCAGCCATGG - Intergenic
1194235982 X:91383532-91383554 AGATACTCTGGCTCCAGCTGTGG + Intergenic
1194244414 X:91493545-91493567 AGCCCCTCAAGCTCCAGCCCTGG - Intergenic
1194302986 X:92209976-92209998 AGCTGTTCCAGCTCCAGTTGTGG - Intronic
1194360355 X:92942191-92942213 AGTTCCTTCAGCTCCAGCTGTGG - Intergenic
1194372249 X:93088521-93088543 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1194397208 X:93401428-93401450 AGCTACTCTAGCTCTATCTGTGG + Intergenic
1194409855 X:93544085-93544107 AGCTGCTCCAGCTCCAGCTGTGG - Intergenic
1194500251 X:94673204-94673226 AGCCACTTCAGCTCTAGCCATGG - Intergenic
1194548913 X:95272612-95272634 AGCCACTCCAGCTTCAGCTGTGG - Intergenic
1194563130 X:95447498-95447520 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1194582806 X:95697440-95697462 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1194590785 X:95797667-95797689 AGACACGCCAGCTCCAGCTGTGG + Intergenic
1194603791 X:95957113-95957135 AGCCACTCCAGCTCTAGCTGTGG + Intergenic
1194864455 X:99048738-99048760 AGCAGCTCTACCTCCAGCTGTGG - Intergenic
1194881195 X:99253829-99253851 AGCCATTCTAGCTCCAGCCTTGG - Intergenic
1194905925 X:99576304-99576326 AGCTGCTTCAGCTCCAGCAGTGG + Intergenic
1194910115 X:99631118-99631140 AGCAACTCCAGCTCCAGCCATGG - Intergenic
1195147163 X:102029326-102029348 AGCCTCTCTGGCTCCAGCAGGGG - Intergenic
1195206915 X:102610695-102610717 AGCTACTTCAACTCCAGCTGTGG + Intergenic
1195243073 X:102972479-102972501 AGCCACTTCAGCTCCAGCCATGG + Intergenic
1195536287 X:106012690-106012712 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1195608378 X:106835319-106835341 AGCTGCTTCAGCTCCAGCTGTGG - Intronic
1195715980 X:107819167-107819189 AGCTGCTCCATCTCCAGCTGTGG + Intergenic
1195721227 X:107871270-107871292 AGCCACTTCAGTGCCAGCAGGGG + Intronic
1195814238 X:108867845-108867867 GGCCACTCCAGCACCAACTATGG - Intergenic
1195822058 X:108956454-108956476 AGCTGGTCCAGCTCCAGCTGTGG + Intergenic
1195838813 X:109149944-109149966 AGCTGCTTCAGCTCAAGCTGTGG + Intergenic
1196029030 X:111075383-111075405 TACTGCTCCAGCTCCAGCTGTGG + Intronic
1196189385 X:112779087-112779109 TCCAACTCCAACTCCAGCTGTGG - Exonic
1196189390 X:112779123-112779145 ACCAACTTCAGCTCCGGCTGTGG - Exonic
1196390665 X:115204167-115204189 AGCCACTCCAGCTTCAGCTGTGG - Intronic
1196512802 X:116532256-116532278 AGCTGCTTCAGCTCCAGCAGTGG - Intergenic
1196524719 X:116718950-116718972 AGCCACTCCAGCTCCAGCCGTGG - Intergenic
1196582566 X:117394135-117394157 AAATACTCCAGCTCCTGCTGTGG - Intergenic
1196903552 X:120410064-120410086 AGCCACTTCAGCTCCAGTGGTGG - Intergenic
1196930438 X:120676245-120676267 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1196970240 X:121100158-121100180 AGCAACTCTAGCTCCAGCTGTGG - Intergenic
1197040400 X:121929762-121929784 AGCCACTCCAGCTTCAGTCTTGG + Intergenic
1197042060 X:121949010-121949032 GGCCACTCCAGCTCTAGCCTTGG - Intergenic
1197375275 X:125675350-125675372 AGCTGTTTCAGCTCCAGCTGTGG - Intergenic
1197441272 X:126494259-126494281 AGCTACTTCAGCTACAGCCGTGG + Intergenic
1197510240 X:127361841-127361863 AGCCATTTCAGCTCTAGCAGTGG - Intergenic
1197594405 X:128449254-128449276 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1197719143 X:129733168-129733190 GGCCACTCCAGCTCCAGCCTTGG + Intergenic
1198274652 X:135089377-135089399 AGGTGCTTCAGCTCCAGCTGTGG + Intergenic
1198297544 X:135302087-135302109 AGCCACTCCAGCTCCAGCCACGG - Intronic
1198304671 X:135368670-135368692 AGTCACTCCAGCTCCAGCTGTGG - Intergenic
1198629281 X:138616898-138616920 AGCTGCTTCAGCTTCAGCTGTGG - Intergenic
1198667938 X:139045215-139045237 GGTCACTCCAGTTCCAGCTGTGG - Intronic
1198817516 X:140608403-140608425 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1198873717 X:141201768-141201790 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1198913420 X:141638647-141638669 AGCTGCTCCAGCTCCAGCCTTGG - Intronic
1198941744 X:141964119-141964141 AGCTATTTCCGCTCCAGCTGTGG - Intergenic
1198943824 X:141987471-141987493 AGTCACTCCAGCTACAGCCATGG + Intergenic
1198947068 X:142027158-142027180 AGCTGCTTCAGCTCCAGCTGTGG - Intergenic
1198952076 X:142082738-142082760 AGCCCCTCCAGCTCCAGCTGTGG - Intergenic
1198966860 X:142236871-142236893 AGCTGCTTCAGCTCCAGCTATGG + Intergenic
1199003016 X:142662843-142662865 AGCTGCTTCAGCTCCAGCTGTGG + Intergenic
1199041471 X:143119730-143119752 TGCCACTCCAGCTGCAGCCATGG - Intergenic
1199062609 X:143376525-143376547 AGCCAATCCAGCTCCAGCCATGG - Intergenic
1199078588 X:143551548-143551570 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1199117419 X:144008795-144008817 AGCCACTCCAGCTCCAGCCCTGG - Intergenic
1199139209 X:144289985-144290007 AGCTGCTCCAGCTTCAACTGTGG + Intergenic
1199185498 X:144910790-144910812 AGCTGCTTCAGCTCAAGCTGTGG - Intergenic
1199196095 X:145032676-145032698 AGCCACTACAGCTCCAGCCATGG + Intergenic
1199306169 X:146269743-146269765 AGCCACTCCAGCTCCAGCTGTGG + Intergenic
1199370466 X:147042204-147042226 AGCCACTCCAGCTCTAGCTGTGG + Intergenic
1199421049 X:147644856-147644878 GGCTGCTCCAGCTCCAGCAGCGG + Intergenic
1199561969 X:149172639-149172661 AACCACTCCAGCTCCAGCCATGG - Intergenic
1199639031 X:149842016-149842038 AGCCACTCCAGCTTCAGCTGTGG - Intergenic
1199908777 X:152262100-152262122 AGTTGCTTCAGCTCCAGCTGTGG - Intronic
1200255444 X:154580098-154580120 AGCTGCTCCAGCTCCAGCCATGG + Intergenic
1200262325 X:154624306-154624328 AGCTGCTCCAGCTCCAGCCATGG - Intergenic
1200268880 X:154662604-154662626 AGCTGCACCAGCTGCAGCTGGGG + Intergenic
1200356981 X:155562308-155562330 AGCCACTCCAGCTCCAACTGTGG - Intronic
1200395390 X:155983566-155983588 AGCTGCTCCAGCTTCAGCTGTGG + Intergenic
1200480779 Y:3700505-3700527 AGTAGCTTCAGCTCCAGCTGTGG + Intergenic
1200496204 Y:3886771-3886793 AGCCATTCCAGCTCCAGCTGTGG - Intergenic
1200497209 Y:3900357-3900379 AGCCACTTAAACTCTAGCTGTGG - Intergenic
1200525546 Y:4270832-4270854 AGCCACTCTATCTCCAGCCATGG - Intergenic
1200539391 Y:4440210-4440232 AGTTATTCCAGCTCCAGCTCTGG + Intergenic
1200552065 Y:4590367-4590389 AGCCTTTCCAGCTCCAGCCATGG - Intergenic
1200563392 Y:4734842-4734864 AGCCCCTCCAGCTCCAGCCATGG - Intergenic
1200668558 Y:6058009-6058031 AGTTCCTTCAGCTCCAGCTGTGG - Intergenic
1200680302 Y:6202565-6202587 AGCTGCTCCAGCTCCAGCTGTGG + Intergenic
1201220142 Y:11760938-11760960 TGCCACTGCAACTCCAGCTTGGG - Intergenic
1201400941 Y:13603103-13603125 AGCCTCCCCAGCTCCAGTGGTGG - Intergenic
1201752221 Y:17445425-17445447 AGCTACTCAAGCCTCAGCTGTGG + Intergenic
1202030863 Y:20572712-20572734 AGCCTCTCCAGCCTCAGCTGTGG - Intergenic
1202099198 Y:21288088-21288110 AGCCACTCCAGCTCCAGCTGTGG + Intergenic