ID: 1099558932

View in Genome Browser
Species Human (GRCh38)
Location 12:84148602-84148624
Sequence CAGCTCCAGCTGTGGCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3608
Summary {0: 144, 1: 312, 2: 656, 3: 1002, 4: 1494}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099558922_1099558932 29 Left 1099558922 12:84148550-84148572 CCCTGCTGCCCTGTGCAACCTTA No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558923_1099558932 28 Left 1099558923 12:84148551-84148573 CCTGCTGCCCTGTGCAACCTTAG No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558924_1099558932 21 Left 1099558924 12:84148558-84148580 CCCTGTGCAACCTTAGAACACTG No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558928_1099558932 -5 Left 1099558928 12:84148584-84148606 CCAGCATTCTAGCCACTCCAGCT No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558926_1099558932 11 Left 1099558926 12:84148568-84148590 CCTTAGAACACTGCTCCCAGCAT No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558925_1099558932 20 Left 1099558925 12:84148559-84148581 CCTGTGCAACCTTAGAACACTGC No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494
1099558927_1099558932 -4 Left 1099558927 12:84148583-84148605 CCCAGCATTCTAGCCACTCCAGC No data
Right 1099558932 12:84148602-84148624 CAGCTCCAGCTGTGGCTAAAAGG 0: 144
1: 312
2: 656
3: 1002
4: 1494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099558932 Original CRISPR CAGCTCCAGCTGTGGCTAAA AGG Intergenic
Too many off-targets to display for this crispr