ID: 1099561301

View in Genome Browser
Species Human (GRCh38)
Location 12:84177749-84177771
Sequence CTCTATAAACTATACATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099561294_1099561301 27 Left 1099561294 12:84177699-84177721 CCATGATTTTTCCCAGATGTGAT No data
Right 1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG No data
1099561297_1099561301 15 Left 1099561297 12:84177711-84177733 CCAGATGTGATGAGAGGAAAAAA No data
Right 1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG No data
1099561296_1099561301 16 Left 1099561296 12:84177710-84177732 CCCAGATGTGATGAGAGGAAAAA No data
Right 1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099561301 Original CRISPR CTCTATAAACTATACATATA GGG Intergenic
No off target data available for this crispr