ID: 1099566977

View in Genome Browser
Species Human (GRCh38)
Location 12:84263768-84263790
Sequence GAGCAATCTTAGAATTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099566975_1099566977 15 Left 1099566975 12:84263730-84263752 CCATTTTTTTTTCTGCTATAGTT No data
Right 1099566977 12:84263768-84263790 GAGCAATCTTAGAATTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099566977 Original CRISPR GAGCAATCTTAGAATTATAA GGG Intergenic
No off target data available for this crispr