ID: 1099574265

View in Genome Browser
Species Human (GRCh38)
Location 12:84361629-84361651
Sequence TCCCCAGGCCCTCCCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099574265_1099574277 29 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574265_1099574272 15 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574272 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
1099574265_1099574276 28 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data
1099574265_1099574270 14 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574270 12:84361666-84361688 CCCCCACAGCCTGCTGCCCAGGG No data
1099574265_1099574268 13 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574268 12:84361665-84361687 ACCCCCACAGCCTGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099574265 Original CRISPR TCCCCAGGCCCTCCCCGCAG TGG (reversed) Intergenic
No off target data available for this crispr