ID: 1099574271

View in Genome Browser
Species Human (GRCh38)
Location 12:84361667-84361689
Sequence CCCCTGGGCAGCAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099574271_1099574285 17 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574285 12:84361707-84361729 GACAAGGTCATCTGCCAGTGGGG No data
1099574271_1099574281 1 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574281 12:84361691-84361713 CCACCGTGACGGGCTAGACAAGG No data
1099574271_1099574283 15 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574283 12:84361705-84361727 TAGACAAGGTCATCTGCCAGTGG No data
1099574271_1099574276 -10 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data
1099574271_1099574286 18 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574286 12:84361708-84361730 ACAAGGTCATCTGCCAGTGGGGG No data
1099574271_1099574277 -9 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574271_1099574284 16 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574284 12:84361706-84361728 AGACAAGGTCATCTGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099574271 Original CRISPR CCCCTGGGCAGCAGGCTGTG GGG (reversed) Intergenic
No off target data available for this crispr