ID: 1099574276

View in Genome Browser
Species Human (GRCh38)
Location 12:84361680-84361702
Sequence TGCCCAGGGGACCACCGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099574267_1099574276 13 Left 1099574267 12:84361644-84361666 CCTGGGGAGCAGGCAGACAGCAC No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data
1099574265_1099574276 28 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data
1099574269_1099574276 -9 Left 1099574269 12:84361666-84361688 CCCCCACAGCCTGCTGCCCAGGG No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data
1099574271_1099574276 -10 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099574276 Original CRISPR TGCCCAGGGGACCACCGTGA CGG Intergenic
No off target data available for this crispr