ID: 1099574277

View in Genome Browser
Species Human (GRCh38)
Location 12:84361681-84361703
Sequence GCCCAGGGGACCACCGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099574273_1099574277 -10 Left 1099574273 12:84361668-84361690 CCCACAGCCTGCTGCCCAGGGGA No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574269_1099574277 -8 Left 1099574269 12:84361666-84361688 CCCCCACAGCCTGCTGCCCAGGG No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574265_1099574277 29 Left 1099574265 12:84361629-84361651 CCACTGCGGGGAGGGCCTGGGGA No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574267_1099574277 14 Left 1099574267 12:84361644-84361666 CCTGGGGAGCAGGCAGACAGCAC No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data
1099574271_1099574277 -9 Left 1099574271 12:84361667-84361689 CCCCACAGCCTGCTGCCCAGGGG No data
Right 1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099574277 Original CRISPR GCCCAGGGGACCACCGTGAC GGG Intergenic
No off target data available for this crispr