ID: 1099575719

View in Genome Browser
Species Human (GRCh38)
Location 12:84378589-84378611
Sequence ATTCCCTATTACCAAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099575712_1099575719 18 Left 1099575712 12:84378548-84378570 CCTAGCATGCCACTTTATGTATA No data
Right 1099575719 12:84378589-84378611 ATTCCCTATTACCAAGTTGAGGG No data
1099575713_1099575719 9 Left 1099575713 12:84378557-84378579 CCACTTTATGTATAAGACTTGAT No data
Right 1099575719 12:84378589-84378611 ATTCCCTATTACCAAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099575719 Original CRISPR ATTCCCTATTACCAAGTTGA GGG Intergenic