ID: 1099576883

View in Genome Browser
Species Human (GRCh38)
Location 12:84393422-84393444
Sequence CTTCCCCCTATAGCTTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576878_1099576883 -3 Left 1099576878 12:84393402-84393424 CCTGGGTTGGGCCAAATTCCCTT No data
Right 1099576883 12:84393422-84393444 CTTCCCCCTATAGCTTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576883 Original CRISPR CTTCCCCCTATAGCTTGAAT GGG Intergenic
No off target data available for this crispr