ID: 1099576944

View in Genome Browser
Species Human (GRCh38)
Location 12:84393807-84393829
Sequence TGAAAACCCTGAAAAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576944_1099576949 3 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG 0: 112
1: 96
2: 39
3: 17
4: 104
1099576944_1099576953 17 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576953 12:84393847-84393869 TGGCTTAGGATGCATTTCAAGGG 0: 152
1: 61
2: 27
3: 20
4: 193
1099576944_1099576952 16 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576952 12:84393846-84393868 ATGGCTTAGGATGCATTTCAAGG 0: 123
1: 86
2: 31
3: 30
4: 148
1099576944_1099576954 29 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576954 12:84393859-84393881 CATTTCAAGGGTGATCCTGTTGG No data
1099576944_1099576948 -3 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576948 12:84393827-84393849 TCAGGTCAAATTGGTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576944 Original CRISPR TGAAAACCCTGAAAAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr