ID: 1099576948

View in Genome Browser
Species Human (GRCh38)
Location 12:84393827-84393849
Sequence TCAGGTCAAATTGGTCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576946_1099576948 -6 Left 1099576946 12:84393810-84393832 CCTCTTTTTCAGGGTTTTCAGGT No data
Right 1099576948 12:84393827-84393849 TCAGGTCAAATTGGTCCCAATGG No data
1099576941_1099576948 19 Left 1099576941 12:84393785-84393807 CCATAGTACAGAAAAAAATGAGC No data
Right 1099576948 12:84393827-84393849 TCAGGTCAAATTGGTCCCAATGG No data
1099576944_1099576948 -3 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576948 12:84393827-84393849 TCAGGTCAAATTGGTCCCAATGG No data
1099576940_1099576948 24 Left 1099576940 12:84393780-84393802 CCAAGCCATAGTACAGAAAAAAA No data
Right 1099576948 12:84393827-84393849 TCAGGTCAAATTGGTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576948 Original CRISPR TCAGGTCAAATTGGTCCCAA TGG Intergenic
No off target data available for this crispr