ID: 1099576949

View in Genome Browser
Species Human (GRCh38)
Location 12:84393833-84393855
Sequence CAAATTGGTCCCAATGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 112, 1: 96, 2: 39, 3: 17, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576941_1099576949 25 Left 1099576941 12:84393785-84393807 CCATAGTACAGAAAAAAATGAGC No data
Right 1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG 0: 112
1: 96
2: 39
3: 17
4: 104
1099576944_1099576949 3 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG 0: 112
1: 96
2: 39
3: 17
4: 104
1099576946_1099576949 0 Left 1099576946 12:84393810-84393832 CCTCTTTTTCAGGGTTTTCAGGT No data
Right 1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG 0: 112
1: 96
2: 39
3: 17
4: 104
1099576940_1099576949 30 Left 1099576940 12:84393780-84393802 CCAAGCCATAGTACAGAAAAAAA No data
Right 1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG 0: 112
1: 96
2: 39
3: 17
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576949 Original CRISPR CAAATTGGTCCCAATGGCTT AGG Intergenic
902115219 1:14115638-14115660 TAAATTGGTACCAATGGAGTGGG + Intergenic
904778152 1:32924644-32924666 CACATTGGTCCCACTGACCTCGG - Intergenic
906766574 1:48439773-48439795 CAAATTGGTCCCAGTGGCTTAGG - Intronic
907591728 1:55680094-55680116 AAAATAGGTCCCAATCTCTTTGG + Intergenic
907842249 1:58169450-58169472 CAAATTGTTCCCAATGGCTTAGG - Intronic
908300308 1:62756045-62756067 CAAATTGGTCCCAATGGCTGAGG - Intergenic
908659853 1:66424231-66424253 CAAATTGATCCCAAAGGCTTAGG + Intergenic
908728116 1:67198389-67198411 CAAATTGTTTTCACTGGCTTTGG - Intronic
909153794 1:72043719-72043741 GAAATTGGTCTGAATGACTTTGG + Intronic
909359515 1:74744427-74744449 CAAATTGGTCCCAATGGCTTAGG + Intronic
910378135 1:86595505-86595527 CAAATTGGTCCCAAGGAGGTGGG - Intergenic
911129878 1:94377033-94377055 CAAATTTGTCCCAATGGCTTAGG + Intergenic
911298863 1:96149695-96149717 CAAATTGGTCCCAATGGCTTAGG - Intergenic
911751311 1:101500657-101500679 CAAATTAGTCCCAATGGCTTAGG - Intergenic
911845727 1:102748321-102748343 CAAATTGGTCCCAATGGCTTAGG + Intergenic
912021187 1:105110806-105110828 CAAATTGGTCCCAATGGCTTAGG - Intergenic
913382516 1:118227322-118227344 GTCATTGGTCCCAATGGCTTAGG - Intergenic
913469404 1:119174083-119174105 CAAATTGGTCCCAGTGGCTTAGG - Intergenic
915260458 1:154673273-154673295 CAAATTGGTCCCAATGGCTTAGG - Intergenic
916083519 1:161251914-161251936 CAAATTGGTCCCAATGGCTTAGG - Intergenic
916114330 1:161474351-161474373 CAAATTGGTCCCAATGGCTTAGG - Intergenic
916939417 1:169663794-169663816 CAAATTGGTCCCAGTGGCTTAGG - Intronic
917086025 1:171306634-171306656 CAAATTGGTCTCAATGGCTTAGG - Intergenic
917227470 1:172800182-172800204 CAAATTGATCCCAATGGCTTAGG - Intergenic
917279781 1:173369634-173369656 CCAGTTGGTCCCAATGGCTTAGG - Intergenic
917445912 1:175105732-175105754 CAAATTGGTCCCAATGGCTTAGG + Intronic
917676173 1:177321402-177321424 CAAATTGGTCCCAATGGCTTAGG - Intergenic
919206186 1:194423781-194423803 CAAATTGGTCCTAATGGCTTAGG - Intergenic
919558554 1:199092043-199092065 CAAATTGGTCCCAGCGGCTTAGG - Intergenic
920880587 1:209876813-209876835 AAAAATGGTCCCAATCCCTTTGG + Intergenic
921019591 1:211223965-211223987 CAAATTGGTCCCAATGGCTTAGG - Intergenic
921391671 1:214621532-214621554 AACATTGGTTCCAATGGCATTGG - Intronic
923534371 1:234837827-234837849 CAGATGGGTTCCCATGGCTTGGG + Intergenic
1063321809 10:5058453-5058475 CAAATTGGTCCCAATGGCTTAGG + Intronic
1063859193 10:10289933-10289955 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1064603673 10:17017061-17017083 CAAATTGGTCCCAATGGCTTAGG + Intronic
1065082305 10:22140580-22140602 CAAATTGGTCCCAGTGGCTTAGG - Intergenic
1065410252 10:25418441-25418463 CACATTTGTCCCTATGCCTTTGG + Intronic
1066614677 10:37282847-37282869 CAAATTTGTCCCATTGGCTTAGG + Intronic
1068240550 10:54297258-54297280 CAAATTGGTCCCAATGGCTTAGG - Intronic
1068500209 10:57834464-57834486 CAAATTGGTCCCAATGACTTAGG - Intergenic
1069137436 10:64783035-64783057 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1069365185 10:67688650-67688672 CAAATTGGTCCCAATGGCTTAGG + Intronic
1071221055 10:83464664-83464686 CAAATTTGTCCCAATGGCTTAGG - Intergenic
1071834758 10:89408148-89408170 CAAATTGGTCCCAATGGCTTAGG - Intronic
1072371751 10:94771593-94771615 CAAATTGGTCCCAATGGCTTAGG + Intronic
1073970660 10:109043055-109043077 CAAATTGGTCCCCATGGCTTAGG - Intergenic
1074612937 10:115038828-115038850 CAAATTAGTCCCAATGGCTTAGG - Intergenic
1074742745 10:116500644-116500666 CAAATTGGTCCTAATGGCTTAGG - Intergenic
1075146238 10:119885299-119885321 CAAATTGGTCTCAGTGGCTTAGG - Intronic
1075391137 10:122093169-122093191 CAAATTGTTCCCAGATGCTTAGG + Intronic
1079731323 11:23939805-23939827 CAAATTGGTCCCTGTGGCTTAGG + Intergenic
1079767328 11:24410998-24411020 CAAATTGTTCCAAATTTCTTTGG - Intergenic
1079811756 11:25005527-25005549 CAAATTGGTCCCAATGACTTAGG + Intronic
1080187861 11:29512191-29512213 CAAATTAGCCACAATGGTTTAGG - Intergenic
1081033330 11:38113269-38113291 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1081145908 11:39562472-39562494 CAAATCGGTCCCAATGGCTTAGG - Intergenic
1081421325 11:42876749-42876771 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1084210898 11:67621805-67621827 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1084513956 11:69625592-69625614 CATATTGGTCACAACGGGTTGGG + Intergenic
1086317293 11:85608262-85608284 CAAATTGGTCCCAATGGCTTAGG - Intronic
1087074912 11:94119954-94119976 CAAATTGCTCCCAATGGCTTAGG - Intergenic
1087319169 11:96638166-96638188 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1087455713 11:98383673-98383695 CAAATCAGTCCCAATGGTTCAGG - Intergenic
1087459088 11:98423222-98423244 CAGATTGGTCCCAATGGCTTAGG + Intergenic
1087683427 11:101238893-101238915 CAAACTGGTCCCAATGGCTTAGG + Intergenic
1088397066 11:109380608-109380630 CAACTGGTTCACAATGGCTTTGG + Intergenic
1088492451 11:110401156-110401178 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1089280247 11:117369038-117369060 TGAAATGTTCCCAATGGCTTTGG - Intronic
1091574004 12:1715397-1715419 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1092472208 12:8790044-8790066 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1094320055 12:29173644-29173666 CAAATTGGTCCCAATAGCTTAGG + Intronic
1094338199 12:29383983-29384005 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1094768690 12:33627668-33627690 CAAATTAGACACAATTGCTTGGG + Intergenic
1097265970 12:57745114-57745136 CCAAGTGGTCCCAAGGACTTGGG - Exonic
1097428208 12:59472639-59472661 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1099238102 12:80106115-80106137 CAAATGGGGCACAATGGCTTTGG - Intergenic
1099376166 12:81898203-81898225 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1099414829 12:82372686-82372708 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1099576949 12:84393833-84393855 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1100050859 12:90446603-90446625 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
1100092063 12:90984420-90984442 CAAATTGGTCTCAATGGCTTAGG - Intronic
1100209700 12:92388361-92388383 CAAATCAGTCCCAATGGCTTAGG - Intergenic
1100530393 12:95456565-95456587 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1101704788 12:107211623-107211645 CAAATTGGTCCCAGTGGCTTAGG - Intergenic
1101779573 12:107823491-107823513 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1104218473 12:126758283-126758305 CAAAATGTCCCCAAGGGCTTGGG - Intergenic
1104306093 12:127612029-127612051 CAAAGTTGTTCCAGTGGCTTAGG - Intergenic
1104767012 12:131336627-131336649 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1105762391 13:23526614-23526636 CAAATTGATCCCAATGGCTTAGG - Intergenic
1106162599 13:27214491-27214513 CAAATTGGTCCCAATGATTTAGG - Intergenic
1106872050 13:34032174-34032196 GAAATTTGTCCCAATGTCTAAGG - Intergenic
1108848537 13:54702177-54702199 CAAATTGGTCCCAATGACTTAGG - Intergenic
1109101285 13:58186536-58186558 CAAATTGTTCCAAATGACTGGGG + Intergenic
1109424216 13:62150569-62150591 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1109500945 13:63235651-63235673 CAAAATTGTCCAAATGGATTAGG - Intergenic
1111372444 13:87335285-87335307 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1112398095 13:99051742-99051764 AAAAGTGGTCCCAATTGCTCAGG + Intronic
1112519023 13:100080048-100080070 CAAATTGGTCCCAGTGGCTTAGG - Intergenic
1113204010 13:107895543-107895565 CAAATTGGTATCAAAGGCTTAGG + Intergenic
1113551595 13:111196990-111197012 CAAATTGGTCCGAATGGCTTAGG + Intronic
1115285549 14:31710167-31710189 CAAATTGGTCCCAATGGCTTAGG + Intronic
1117668177 14:58078832-58078854 TACATTGGTCCCATTGGCTTAGG - Intronic
1120198701 14:81514769-81514791 CAAATTGGTCCCAATGGCTTAGG - Intronic
1126072157 15:44874645-44874667 CAAATTCATCCCAATGGCTTAGG + Intergenic
1126086031 15:45012020-45012042 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1126158758 15:45588934-45588956 GAAATTGGTGCCAATTTCTTAGG + Intronic
1126986815 15:54321076-54321098 CAAAGTGGTCCTAAAAGCTTTGG - Intronic
1130298320 15:82662678-82662700 GAAATTGGTGCGAAGGGCTTTGG - Exonic
1130999094 15:88924144-88924166 CAAAATGGGCTCATTGGCTTTGG + Intergenic
1131411114 15:92209068-92209090 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1135339769 16:21635692-21635714 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1137006035 16:35275089-35275111 CACATAGGTCCCACTGGCCTCGG - Intergenic
1137543341 16:49379525-49379547 CAATTTGGTCACAATGGCTTTGG - Intronic
1141360475 16:83391052-83391074 CAAATGGGTTCCAATGACTCAGG + Intronic
1144949510 17:18986443-18986465 TAAATTGGTCGGAATTGCTTTGG + Intronic
1149073805 17:52574940-52574962 CTAATTGGCCCCAATGGCTTAGG - Intergenic
1149209576 17:54287999-54288021 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1151567910 17:74910118-74910140 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1153437957 18:5087218-5087240 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1154022561 18:10677050-10677072 AAAATGGGTCCCAATAGCTGAGG + Intronic
1155036022 18:22025782-22025804 CCAAATGGTCCCTATGGTTTGGG + Intergenic
1155476213 18:26237858-26237880 CAAATTGGTCCCAGGGGCTTAGG + Intronic
1157421999 18:47555325-47555347 CAGATTGATCTCCATGGCTTTGG - Intergenic
1157857998 18:51118733-51118755 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
1159881181 18:73859815-73859837 CAAATTCTTCCCAATGGTCTGGG + Intergenic
1161598327 19:5164163-5164185 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1161991511 19:7686902-7686924 CAACTTGGTCCCAGCTGCTTGGG - Exonic
1162107825 19:8381233-8381255 CAGACTGGTCCCAATGGCCTAGG - Intronic
1164497831 19:28784401-28784423 CAAATTGGTGGCAATGAGTTGGG + Intergenic
1164993046 19:32698332-32698354 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1165272647 19:34724002-34724024 CACATAGGTCCCACTGGCCTCGG + Intergenic
1165846982 19:38824484-38824506 CAAATTGGTCCCAACGGCTTAGG - Intronic
925641087 2:5986500-5986522 CCAATTGGTCCCATTCGCATGGG + Intergenic
925949992 2:8900942-8900964 CAAATTGGTCCCAATGGCTTAGG + Intronic
928124428 2:28605926-28605948 CATATTGGTCCAAAGGGCTCTGG - Exonic
928617728 2:33056222-33056244 CGAATTGGTCCCAATAGCTTAGG + Intronic
929330274 2:40673923-40673945 CAAATTGGTCACAATGGCTTAGG - Intergenic
929754409 2:44752123-44752145 CAATTTGGGCCCCATGGTTTTGG + Intronic
930038421 2:47102342-47102364 CAAATTGGTCCCAAAGGCTTAGG - Intronic
930433015 2:51304691-51304713 CAAATTGGTAGGCATGGCTTTGG - Intergenic
931540378 2:63324008-63324030 CAAATTGGTCCCAATGGCTTAGG - Intronic
931749658 2:65319253-65319275 GAAATTAGTCACCATGGCTTGGG - Intronic
933760544 2:85669032-85669054 TAAATTGATCACAATGGCTGGGG - Intergenic
933809184 2:86021817-86021839 CAAGTTGGACTCAATGGCCTGGG - Exonic
934867019 2:97822862-97822884 CAAATTGGTCCCAATGGCTTAGG - Intronic
937639625 2:124196836-124196858 CAACATGGTCCCCAGGGCTTGGG - Intronic
938806292 2:134809642-134809664 CAAATTGGTCCCAACGGCTTAGG + Intergenic
939554357 2:143656455-143656477 CAAATTGGTTCCAGTGGAGTGGG - Intronic
939851754 2:147313146-147313168 CAAATTGGCCCCAATGGCTTGGG - Intergenic
940342979 2:152600660-152600682 CAGATTGATCCAAATGGTTTGGG + Intronic
940653138 2:156457260-156457282 CAAAGTTGTCCCAATGACTTGGG + Intronic
941243313 2:163068520-163068542 CAAATTGGTCCTAATGGCTTAGG - Intergenic
941537651 2:166742399-166742421 CAAATTGGTTCCAATGGCTTAGG + Intergenic
941877722 2:170451967-170451989 CAAAATGGGCCGATTGGCTTTGG - Intronic
942342973 2:174969106-174969128 CAAATCTGTCCCAAGGGTTTTGG + Intronic
943103172 2:183511181-183511203 CAAATTAGTCCCAATGGCTTAGG + Intergenic
943133647 2:183887199-183887221 CAAATTGGTCCCAAAGGCTTAGG - Intergenic
944230790 2:197390124-197390146 CTATTTGGTCCCAATGTTTTAGG + Exonic
944728891 2:202498676-202498698 CAAATTGGTCCCAATGGCTTAGG - Intronic
946207461 2:218120173-218120195 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1171261406 20:23737689-23737711 CAAATTGGTTCCAATGGCTTAGG - Intergenic
1171270538 20:23813580-23813602 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1172340545 20:34154193-34154215 CGAATTGGTCCCAATGGCTTAGG - Intergenic
1174220482 20:48950581-48950603 CAGATTGGTCCCAAACTCTTGGG - Intronic
1177134961 21:17298552-17298574 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1182552041 22:31105849-31105871 CAACATGGTCCCAATGACTGGGG - Intronic
1184042513 22:41952448-41952470 CCGAGTGGTGCCAATGGCTTGGG + Intergenic
949449075 3:4165757-4165779 CAAATTGGCCCCAATGGCTTAGG + Intronic
951020388 3:17776231-17776253 CAAATTTGTACCAATGGCTTAGG - Intronic
951239357 3:20271453-20271475 CAAATTGGTCCCAATGGCTTAGG - Intergenic
952941058 3:38444687-38444709 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
953623051 3:44549148-44549170 CAAATTGGTCCCAATGGCTTAGG + Intergenic
954232374 3:49227307-49227329 CAAATTGGTCCCAATGGCTTAGG + Intronic
954586876 3:51744084-51744106 CAAATTGGTCCCAATGGCTTAGG - Intergenic
954598815 3:51851929-51851951 CAAATTGGCCCCAATGGCTTAGG - Intergenic
956843070 3:73157738-73157760 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
957123838 3:76132430-76132452 CACGTTTGTCCAAATGGCTTAGG + Intronic
957721838 3:84012296-84012318 CATATTTGTCCCTTTGGCTTAGG - Intergenic
958601284 3:96299551-96299573 CAAATTGGTCCCAATAGCTTAGG - Intergenic
959063228 3:101634272-101634294 CACATAGGTCCCACTGGCCTCGG + Intergenic
960063580 3:113348290-113348312 CAAATTGGTCCCAGTTGCTTAGG - Intronic
963021149 3:140874112-140874134 CAAATTGGTCCCAATGGCTTAGG - Intergenic
963409311 3:144908063-144908085 CAAATTGGTCCCAATGGCTTAGG + Intergenic
964972134 3:162576291-162576313 CAAATTGATCCCAATGGCTTAGG - Intergenic
965007543 3:163044684-163044706 CAAATTTGTCCCAATGTTTTAGG + Intergenic
965062636 3:163803351-163803373 CAAATTGGTCCCAATGGCTTAGG - Intergenic
970448875 4:16147887-16147909 CCAATTGGTGCCTATGCCTTTGG - Intergenic
971281320 4:25244605-25244627 CAAATTGGTCCCAATGGCTTAGG + Intronic
971578365 4:28304785-28304807 CATATTGGTCCCAATGGCTTAGG - Intergenic
973045756 4:45533224-45533246 CAAATTTGTCCCAATGGCTTAGG - Intergenic
974174386 4:58306128-58306150 CAAATTGTTCCCAATGGCTTAGG - Intergenic
974187201 4:58459863-58459885 CAAATTGGTCCCAATGGCTTAGG - Intergenic
974526442 4:63054620-63054642 CAAATTGGTCCAAATGGCTTAGG - Intergenic
974537021 4:63186402-63186424 CAAATTGGTCCCAGTGGCTTAGG - Intergenic
974838960 4:67280528-67280550 CAAATTGGTCCCAATGGCTTAGG + Intergenic
975047880 4:69826609-69826631 CAAATTGGTCCCAATGAGTTAGG - Intronic
975595959 4:76048410-76048432 CAAATTGGTCCCAATGGCTTAGG + Intronic
975992040 4:80267279-80267301 CAGCTTGGTCCCAGTGGCCTGGG - Intronic
976174429 4:82337263-82337285 CAAATTGGTCCCAATGGCTTAGG + Intergenic
977835033 4:101636498-101636520 CAAATTGGTCCCAATGGCTTAGG + Intronic
977883981 4:102237082-102237104 CAAATTGGTCCCAATGGCTTGGG - Intergenic
978747062 4:112207224-112207246 CAAACTGGTCCCAATGGCTTAGG - Intergenic
980219921 4:129901353-129901375 GAAATTTGTCCCAATGTTTTAGG - Intergenic
980291007 4:130847441-130847463 CAAATTTGTCCCAATGCCTTGGG + Intergenic
982398670 4:154941506-154941528 CAAATTAATCCCCATGGCTAGGG - Intergenic
982701012 4:158659752-158659774 CAAATTGGCCCCAATGGCTTAGG - Intergenic
982877187 4:160664123-160664145 CAAATTGGTCCCAATGGCTTAGG - Intergenic
983835041 4:172375398-172375420 CAAATTGGTCCCAATAGCTTTGG + Intronic
984320185 4:178185628-178185650 CAAATATGTGCCATTGGCTTGGG + Intergenic
984553413 4:181186317-181186339 CAAATTGGTCCCAGTAGAGTGGG - Intergenic
984831649 4:183981112-183981134 CATATTTGTCCCAAGGGATTGGG + Intronic
984917332 4:184736219-184736241 CAAATTGGTGCCAACGGCTTAGG - Intergenic
987545354 5:19305532-19305554 CAGATTGTTCCCAGTGGCTTAGG + Intergenic
987929779 5:24388955-24388977 CAAATTGGTCCCAATGGCTTAGG - Intergenic
988357698 5:30199399-30199421 CCAATTGGTCCCAGTGGCTTAGG - Intergenic
988592133 5:32558089-32558111 CAAATTGGTCCCATTGGCTTAGG + Intronic
988605610 5:32676209-32676231 CAAATTGGTCCCATTGGCTTAGG + Intergenic
989241435 5:39207202-39207224 CAAATTGCTTCAAATGGCTTTGG - Intronic
989298518 5:39860362-39860384 CAAAGTTGTCCCAAAGGCTGAGG - Intergenic
989496127 5:42113088-42113110 CAAATTGGTCCCAATGGCTTAGG - Intergenic
989957233 5:50372113-50372135 CAAATTTGTCCCAATGGCTTAGG - Intergenic
989964480 5:50451809-50451831 CAAATTGGTCCCAATGGCTTAGG + Intergenic
990116620 5:52399077-52399099 GAAATTGGTCCCAATGGCTTAGG - Intergenic
990367987 5:55089403-55089425 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
992049249 5:72928086-72928108 CAAATTGGTCCCAATGGCTTAGG - Intergenic
992455080 5:76909272-76909294 CAAATTGGTCCCATTGGCTTAGG - Intronic
992545652 5:77811787-77811809 CAAATTGGTCCCAATGGCTTAGG - Intronic
992828777 5:80573839-80573861 CAATTTGGTTTGAATGGCTTGGG - Intergenic
994231856 5:97316490-97316512 CAAATTCATCCCAATGACTTAGG + Intergenic
994348408 5:98715945-98715967 CAAATGGGACCCAATAGCTAAGG - Intergenic
995583540 5:113624027-113624049 CAAATTGGTCCCAATGGCTTAGG + Intergenic
996099352 5:119431076-119431098 CAAATTGGTCCCAATAGCTTAGG + Intergenic
996463641 5:123774711-123774733 CAAATTGGTTCAGAAGGCTTTGG - Intergenic
996680258 5:126223075-126223097 CAAATTGGTCCCAATGGCTTAGG - Intergenic
997072284 5:130635373-130635395 CAAATTGGTCCCAATGGCTTAGG - Intergenic
998111345 5:139505113-139505135 CAAATTGGTCCTAATGACTGAGG - Intergenic
998914943 5:147002922-147002944 CAAATTGGTCCCAATGGCTTAGG - Intronic
1000085110 5:157881797-157881819 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1000277922 5:159755490-159755512 CACACTGGTGCCAATGGCATGGG - Intergenic
1000580888 5:163034432-163034454 CAAATTGGTACCAAGGGAGTAGG + Intergenic
1003805669 6:9724076-9724098 CAAATTGGTCCCAATGGCCTAGG - Intronic
1004531245 6:16457468-16457490 CAAATTGGTCCCAATGGCTTAGG - Intronic
1004812120 6:19273003-19273025 CAAATTGGTCCCAATGATTTAGG - Intergenic
1006221663 6:32496803-32496825 CAAACTGGTCCCAATGGCTTAGG - Intergenic
1007029903 6:38618184-38618206 CAAATTGGTCCCAGTGGCTTAGG - Intronic
1008050097 6:46892250-46892272 CAAAGTGGTCCCATTTACTTTGG - Intronic
1008587123 6:52960271-52960293 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1009386057 6:63085016-63085038 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1009407827 6:63331451-63331473 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1009470682 6:64026402-64026424 CAAATTGGTCCCAATGGCTTAGG - Intronic
1009872654 6:69469917-69469939 CAAATGGGTCCCAATGGCTTAGG - Intergenic
1010024341 6:71198290-71198312 CAAATTCATCCCCATGACTTAGG - Intergenic
1010074825 6:71787341-71787363 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1010269710 6:73905659-73905681 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1011375168 6:86679609-86679631 CAAATTGGTTGCAGTGGCTTAGG + Intergenic
1012441680 6:99267034-99267056 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1013907974 6:115239375-115239397 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1013977294 6:116092870-116092892 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1016183903 6:141177940-141177962 CAAATTGGTCCCAATGTCTTAGG - Intergenic
1017571168 6:155746325-155746347 CAAATTGTTCCAAATGGATTTGG + Intergenic
1018286513 6:162245401-162245423 TAAATTGGTTCAAAAGGCTTTGG - Intronic
1020470921 7:8533723-8533745 CAAATAGGACCCAGTGGCATTGG + Intronic
1021356700 7:19659250-19659272 CAAATTGGTTCCAATGGCTTAGG + Intergenic
1021756848 7:23860300-23860322 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1023078078 7:36502983-36503005 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
1023151171 7:37202829-37202851 CAAATTGGTCCCAATGGCTTAGG + Intronic
1024735158 7:52296594-52296616 CAAATTTCTCCCAGTGGCTTAGG - Intergenic
1024870911 7:53960988-53961010 CAAATTTGTCCCGATGGCTTAGG + Intergenic
1025904571 7:65773975-65773997 AAAATTAGTCCTAATGACTTAGG + Intergenic
1027790998 7:82638867-82638889 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1028495348 7:91454548-91454570 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1028936384 7:96468970-96468992 CAAATTGTTCCATATGGCTTTGG - Intergenic
1031731647 7:125309601-125309623 CAATTTGGTCCCAATGGCTTAGG - Intergenic
1032649228 7:133859027-133859049 CAAATTGGTGCCACTGGGTGGGG - Intronic
1033759381 7:144423143-144423165 CAAATTGGTCCCAATAGCTTAGG + Intergenic
1034580108 7:152034503-152034525 CAAATTGGTCCCAGTGGCTTAGG + Intronic
1037139351 8:15501561-15501583 CAAATTGGTCACAATGTTTTGGG + Intronic
1038638658 8:29306756-29306778 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1039693307 8:39883714-39883736 CAAATTGGTCCCAATGACTGAGG + Intergenic
1039905973 8:41786616-41786638 CAAATTGCTCCGAATGTCTCAGG - Intronic
1039999809 8:42566373-42566395 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1040527082 8:48234822-48234844 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1040557311 8:48492284-48492306 CCAACTGGTACCAATGCCTTAGG + Intergenic
1040668000 8:49655227-49655249 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1040796929 8:51297499-51297521 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1040953251 8:52956417-52956439 CAAATTGGTCCCCATGGCTTAGG - Intergenic
1040965187 8:53075319-53075341 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1040971594 8:53141777-53141799 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1041000059 8:53441083-53441105 CAAATTGGTCCCAATGGCTTGGG + Intergenic
1041001779 8:53461361-53461383 CAAATTGGTCCCAATGGCTTGGG - Intergenic
1041212244 8:55563948-55563970 CAACCTTGTCCCCATGGCTTTGG - Intergenic
1041346330 8:56902237-56902259 CGAATGGCGCCCAATGGCTTCGG + Intergenic
1041534434 8:58910054-58910076 CAAATTGGTCTCTGTGGCTGGGG - Intronic
1042771778 8:72389729-72389751 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1042919480 8:73907791-73907813 CAAATTGGTGCCAATGGCTTAGG - Intergenic
1043256931 8:78149392-78149414 CAAATTGGTCCCAATTGCTTAGG - Intergenic
1044456755 8:92399115-92399137 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1045858415 8:106790336-106790358 CAAATTGGTCCTAATTGTTTAGG - Intergenic
1046778749 8:118192649-118192671 TAAATTGGAGCCAATGGTTTGGG - Intronic
1048582879 8:135744979-135745001 CAAATAGGTCCAAAGGGTTTTGG + Intergenic
1051935137 9:22436319-22436341 CAAATTGGTCCCAAAGGCTTAGG - Intergenic
1051940715 9:22502323-22502345 CAAATATGTGCCAATGGTTTTGG - Intergenic
1052057907 9:23924095-23924117 CAAATTGGTCTCAATGCCTTAGG + Intergenic
1052637718 9:31124738-31124760 CAAATTTATCCCAATGTTTTAGG + Intergenic
1053623465 9:39844168-39844190 CAAATTGTACACAATGACTTGGG + Intergenic
1053881403 9:42599060-42599082 CAAATTGTACACAATGACTTGGG - Intergenic
1054220434 9:62406531-62406553 CAAATTGTACACAATGACTTGGG - Intergenic
1054230281 9:62502641-62502663 CAAATTGTACACAATGACTTGGG + Intergenic
1055256773 9:74381113-74381135 CAAACTGGTCCCAATATCTGAGG + Intergenic
1055914503 9:81387063-81387085 CAAATTGGAACCAATGACATAGG - Intergenic
1056392922 9:86155498-86155520 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1057856199 9:98602669-98602691 CAAATTGTTCCCTAGTGCTTGGG - Intronic
1059359826 9:113733565-113733587 CAACATGGTCCCATTGACTTTGG + Intergenic
1188136389 X:26499245-26499267 CAAATTTGTCCCAGTGGCTTAGG - Intergenic
1189539211 X:41968861-41968883 TAAATTTGTGCCACTGGCTTTGG - Intergenic
1190433669 X:50402517-50402539 GAAATTGGTCCAAATGACCTTGG + Intronic
1190541320 X:51481403-51481425 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1191206071 X:57835227-57835249 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1192482903 X:71500417-71500439 CAAATTGGTCTCAATGGCTTAGG + Intronic
1192870153 X:75176976-75176998 CAAATTGGTCCTAATGGCTTAGG + Intergenic
1194125370 X:90009783-90009805 CAAGCTGGTCCCAAAGACTTGGG + Intergenic
1194233342 X:91350968-91350990 CAGATTGGTCTCAATCTCTTGGG - Intergenic
1194816541 X:98448518-98448540 CAAAGTGATCACAATTGCTTGGG - Intergenic
1195439432 X:104884529-104884551 CAAATTGGTCCCAATGGCTTAGG - Intronic
1195552521 X:106185241-106185263 CAAATTGGTCCCAATGGCTTAGG + Intronic
1196127487 X:112115019-112115041 CAAATTGGTCCCAATGGCATAGG + Intergenic
1196419524 X:115507850-115507872 CAAATTGGTTCCAATGGCTTAGG + Intergenic
1196488852 X:116245276-116245298 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1196662085 X:118280143-118280165 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1198078561 X:133217284-133217306 AAATTTGGTCCCAAAGGCTCTGG - Exonic
1198540695 X:137636428-137636450 CAAAGTGGTCTCAAAGGCATAGG - Intergenic
1199832550 X:151560439-151560461 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1200695095 Y:6351661-6351683 CAAATTGGTCCCGATGGCTTAGG + Intergenic
1200711140 Y:6486057-6486079 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1200776093 Y:7171567-7171589 CAAATTTGTCCCAAGGGCTTAGG - Intergenic
1200801151 Y:7388101-7388123 CAGTTTGGTCCCAATGGCTTAGG + Intergenic
1200880929 Y:8210612-8210634 CAAATTGATCACAATGGCTTAGG + Intergenic
1200959202 Y:8981762-8981784 CAAATTGGTCCCAATGGCTAAGG - Intergenic
1201022795 Y:9675929-9675951 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1201040182 Y:9823049-9823071 CAAATTGGTCCCGATGGCTTAGG - Intergenic
1201272050 Y:12264924-12264946 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1201312182 Y:12606927-12606949 GGGTTTGGTCCCAATGGCTTAGG + Intergenic
1201340096 Y:12924648-12924670 CAAAATGGTCTCAATGGTTCAGG + Intergenic
1201403648 Y:13629585-13629607 TAAATTGCTCCCAATGGCTTAGG - Intergenic
1201407634 Y:13664572-13664594 CTAATTGGTTACAGTGGCTTAGG + Intergenic
1201468703 Y:14312012-14312034 CAAATTGATCCAAATGGCTTAGG - Intergenic
1201487442 Y:14508096-14508118 CAAATTGGTCCCAATGGCTTAGG - Intergenic
1201496541 Y:14595624-14595646 CAAATTGGTCCCAATGGCTTAGG + Intronic
1201516096 Y:14819930-14819952 CAAATTGTTCCCAATGGCTTAGG + Intronic
1201530433 Y:14985238-14985260 CAAATTGGTCCTGATGGCTTAGG - Intergenic
1201604593 Y:15771230-15771252 CAAATTGGCCCCAGTGGCTTAGG - Intergenic
1201631131 Y:16073031-16073053 CAAATTGGTGCCAGTGGCTTAGG - Intergenic
1201649024 Y:16265126-16265148 CAAATTGGTGCCAATGGCTTAGG + Intergenic
1201653785 Y:16320174-16320196 CAAATTGGTGCCAATGGCTTAGG - Intergenic
1201729718 Y:17190870-17190892 CAAATTTGTCTCAATGGCTTAGG + Intergenic
1201744115 Y:17352167-17352189 CAAATTCATCCCAATGGCTTAGG + Intergenic
1201989648 Y:20009710-20009732 CAAATTGGTCTCAGTGGCTTAGG + Intergenic
1202074832 Y:21027324-21027346 CAATTTGGTCCCAATGGCTTAGG + Intergenic
1202089999 Y:21179278-21179300 CAAATTGGTCCCAGTGGCTTAGG + Intergenic
1202146814 Y:21807080-21807102 CAAACTGGTCCCAGTGGCTTAGG + Intergenic
1202192745 Y:22261079-22261101 CAAATTGGTCCCAATGGCTTAGG + Intergenic
1202242749 Y:22787930-22787952 CAAATTGGTACCATTGGCTTAGG - Intergenic
1202257700 Y:22938784-22938806 AAAATTGGTCCCAATGGCTTAGG - Intergenic
1202395736 Y:24421680-24421702 CAAATTGGTACCATTGGCTTAGG - Intergenic
1202410690 Y:24572531-24572553 AAAATTGGTCCCAATGGCTTAGG - Intergenic
1202460091 Y:25097541-25097563 AAAATTGGTCCCAATGGCTTAGG + Intergenic
1202475049 Y:25248412-25248434 CAAATTGGTACCATTGGCTTAGG + Intergenic