ID: 1099576952

View in Genome Browser
Species Human (GRCh38)
Location 12:84393846-84393868
Sequence ATGGCTTAGGATGCATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 123, 1: 86, 2: 31, 3: 30, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576946_1099576952 13 Left 1099576946 12:84393810-84393832 CCTCTTTTTCAGGGTTTTCAGGT No data
Right 1099576952 12:84393846-84393868 ATGGCTTAGGATGCATTTCAAGG 0: 123
1: 86
2: 31
3: 30
4: 148
1099576944_1099576952 16 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576952 12:84393846-84393868 ATGGCTTAGGATGCATTTCAAGG 0: 123
1: 86
2: 31
3: 30
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576952 Original CRISPR ATGGCTTAGGATGCATTTCA AGG Intergenic
906766563 1:48439713-48439735 ATGGCTTAGGATGCATTTCAAGG - Intronic
906766571 1:48439760-48439782 GTGGCTTAGGATGCATTTCAAGG - Intronic
907842246 1:58169437-58169459 ATGGCTTAGGATGCATTTTAAGG - Intronic
908300305 1:62756032-62756054 ATGGCTGAGGATGCATTTCAAGG - Intergenic
908659856 1:66424244-66424266 AAGGCTTAGGATGCATTTCAAGG + Intergenic
908675584 1:66599832-66599854 ATGGCTGATCCTGCATTTCAGGG + Intronic
909359518 1:74744440-74744462 ATGGCTTAGGATGCATTTCAAGG + Intronic
909465645 1:75971124-75971146 ATGGCATACGAAGCCTTTCAGGG + Intergenic
909879067 1:80849411-80849433 ATGACAGAGGATGCATTACAAGG - Intergenic
910397607 1:86807920-86807942 ATGTCTTACAATGCATTTCAAGG + Intergenic
910845700 1:91602857-91602879 ATTGCATAGTTTGCATTTCATGG + Intergenic
911129881 1:94377046-94377068 ATGGCTTAGGATGCATTTCAAGG + Intergenic
911298860 1:96149682-96149704 ATGGCTTAGGATGCATTTCAAGG - Intergenic
911751308 1:101500644-101500666 ATGGCTTAGGATGCATTTCAAGG - Intergenic
911845730 1:102748334-102748356 ATGGCTTAGGATGCATTTCAAGG + Intergenic
912021184 1:105110793-105110815 ATGGCTTAGGATGCATTTCAAGG - Intergenic
912123031 1:106496971-106496993 ATTGCATAGGATGAATTCCAGGG - Intergenic
913359588 1:117965247-117965269 AAGCCTTAGGAAGAATTTCAAGG - Exonic
913382513 1:118227309-118227331 ATGGCTTAGGATGCATTTCAAGG - Intergenic
913469401 1:119174070-119174092 GTGGCTTAGGATGCATTTCAAGG - Intergenic
914607801 1:149272387-149272409 ATGTCCTAGGAGGCAGTTCAGGG - Intergenic
915260455 1:154673260-154673282 ATGGCTTAGGATGCATTTCAAGG - Intergenic
915536534 1:156539562-156539584 ATGGCTGACCATGCACTTCAAGG + Intronic
916015116 1:160742828-160742850 AGGGCTTAGGCTGTATCTCACGG + Intronic
916083516 1:161251901-161251923 ATGGCTTAGGATGCATTTCAAGG - Intergenic
916114327 1:161474338-161474360 ATGGCTTAGGATGCGTTTCAAGG - Intergenic
916662515 1:166935544-166935566 ATCCCTGAGGATGCACTTCAGGG + Intronic
916939414 1:169663781-169663803 GTGGCTTAGGATGCATTTCAAGG - Intronic
917086024 1:171306621-171306643 ATGGCTTAGGATGCATTTCAAGG - Intergenic
917227467 1:172800169-172800191 ATGGCTTAGGATGCATTTCAAGG - Intergenic
917279778 1:173369621-173369643 ATGGCTTAGGATGCATTTCAAGG - Intergenic
917281042 1:173378467-173378489 ATGGCTTAGAATACATTTCAGGG - Intergenic
917445915 1:175105745-175105767 ATGGCTTAGGATGCATTTCAAGG + Intronic
917676170 1:177321389-177321411 ATGGCTTAGGATGCATTTCAAGG - Intergenic
918724652 1:187904460-187904482 ATGGCAAAGGGTACATTTCAAGG - Intergenic
918750280 1:188261959-188261981 GTGGCTTCAGATGCATTTCAAGG + Intergenic
919206184 1:194423768-194423790 ATGGCTTAGGATGCATTTCAAGG - Intergenic
919558551 1:199092030-199092052 GCGGCTTAGGATGCATTTCAAGG - Intergenic
921821368 1:219620906-219620928 ATGGATTAGGATGCCCTTTAGGG - Intergenic
1063321812 10:5058466-5058488 ATGGCTTAGGATGCATTCCAAGG + Intronic
1063859196 10:10289946-10289968 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1064603676 10:17017074-17017096 ATGGCTTAGGACACATTTCAAGG + Intronic
1065082302 10:22140567-22140589 GTGGCTTAGGATGCATTTCAAGG - Intergenic
1065348805 10:24776416-24776438 ATGGCTTAGGATGGATGGTAAGG - Intergenic
1068240547 10:54297245-54297267 ATGGCTTAGGATGCATTTCAAGG - Intronic
1068500206 10:57834451-57834473 ATGACTTAGGATGCATTTCAAGG - Intergenic
1068897133 10:62218211-62218233 ATGGCTGAGGATGCATTTGCAGG - Exonic
1069187446 10:65442795-65442817 ATTGCTTAGGTTGTATTCCATGG - Intergenic
1069365188 10:67688663-67688685 ATGGCTTAGGATGCATTTCAAGG + Intronic
1069376462 10:67798088-67798110 TTTCCTTAGGATACATTTCAAGG - Intronic
1071020495 10:81048747-81048769 ATGCCTGAGGATATATTTCAGGG + Intergenic
1071073390 10:81722860-81722882 ATAGATTAGTTTGCATTTCATGG - Intergenic
1071145232 10:82561658-82561680 AAGGGTTAGGATCCATTTTAAGG - Intronic
1071221052 10:83464651-83464673 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1071834755 10:89408135-89408157 ATGGCTTAGGATGCATTTCAAGG - Intronic
1072371754 10:94771606-94771628 ATGGCTTAGGATGCATTTCAAGG + Intronic
1072546282 10:96442085-96442107 AGAGCTCAGCATGCATTTCAGGG - Intronic
1073593969 10:104782248-104782270 GTGGCTTAGGATGTATCTCCCGG + Intronic
1073970656 10:109043042-109043064 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1074342712 10:112649646-112649668 ATGCCTAAGGATGCATTTCTCGG - Intronic
1074572462 10:114636407-114636429 AAGGCTCTGGCTGCATTTCAAGG + Intronic
1074612934 10:115038815-115038837 ATGGCTTAGGATACATTTCAAGG - Intergenic
1074742743 10:116500631-116500653 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1075146237 10:119885286-119885308 GTGGCTTAGGATGCATTTCAAGG - Intronic
1075601887 10:123775541-123775563 ATGGCTAAGTGTGCATCTCAAGG - Intronic
1075922980 10:126228291-126228313 ATATCTTAGGATGCACTTTATGG - Intronic
1079731326 11:23939818-23939840 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1079811759 11:25005540-25005562 ATGACTTAGGATGCATTTCCAGG + Intronic
1079923535 11:26461976-26461998 ATGTCTTAGGATGCAGTTAATGG - Intronic
1080714940 11:34791038-34791060 ATAGCTTAGGGTGGACTTCAAGG - Intergenic
1081033327 11:38113256-38113278 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1081145905 11:39562459-39562481 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1081154220 11:39669087-39669109 ATGGCTTATGATACAATTCCAGG - Intergenic
1081421322 11:42876736-42876758 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1082761433 11:57130731-57130753 ATGGCTTAGGCTAGACTTCAAGG - Intergenic
1082906230 11:58310920-58310942 ATGGCTTAGAATGCATTTCAAGG + Intergenic
1082987017 11:59177828-59177850 ATGGTTTGGAAAGCATTTCAAGG - Intronic
1084210895 11:67621792-67621814 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1085204414 11:74722068-74722090 GTGGGTTAGGATGAAGTTCAGGG + Intronic
1086317290 11:85608249-85608271 ATGGCTTAGGATGCATTTCAAGG - Intronic
1086463660 11:87031709-87031731 CTGGCTTTGGAAGCATATCAGGG + Intergenic
1087074909 11:94119941-94119963 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1087319166 11:96638153-96638175 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1087459091 11:98423235-98423257 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1087683430 11:101238906-101238928 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1087858866 11:103128382-103128404 ATGGATTGGGATGCAATTGATGG + Intronic
1088492448 11:110401143-110401165 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1088569636 11:111210474-111210496 ATGTTTTATGATGCATATCAAGG + Intergenic
1088622832 11:111704203-111704225 ACTGCTCAGGATGCACTTCATGG - Intronic
1089314108 11:117578947-117578969 ATGGGTTGGGATGCCCTTCATGG - Intronic
1091574007 12:1715410-1715432 GTGGCTTAGGATGCATTTCAAGG + Intronic
1092472205 12:8790031-8790053 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1092636797 12:10460032-10460054 ATTGCCTAGGTTGCCTTTCAGGG + Intergenic
1092726535 12:11491796-11491818 AAGACTTAGGATGCTCTTCACGG - Intronic
1093154266 12:15662249-15662271 ATTGACAAGGATGCATTTCATGG - Intronic
1093530873 12:20161391-20161413 ATGGGAAAGGAGGCATTTCAAGG + Intergenic
1093580658 12:20781529-20781551 ATGGCTTAGCATGCATTTCAAGG + Intergenic
1094320058 12:29173657-29173679 ATAGCTTAGGATGCATTTCAAGG + Intronic
1094338202 12:29383996-29384018 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1094817497 12:34202798-34202820 ATGGCCTAGGCTGTCTTTCAAGG - Intergenic
1097397396 12:59092364-59092386 TTTTCTTAGGCTGCATTTCAGGG - Intergenic
1097428205 12:59472626-59472648 ATGGCTTAGGATGCATTTTAAGG - Intergenic
1098068267 12:66643252-66643274 TTTCCTTAGGATGCATTTCTAGG - Intronic
1099157675 12:79199595-79199617 CAGGCTTTGGATGCATTTCTAGG - Intronic
1099376163 12:81898190-81898212 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1099414832 12:82372699-82372721 GTGGCTTAGGATGCATTTCAAGG + Intronic
1099576952 12:84393846-84393868 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1100050862 12:90446616-90446638 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1100092062 12:90984407-90984429 ATGGCTTAGGATGCATTTTAAGG - Intronic
1100209697 12:92388348-92388370 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1100433120 12:94547927-94547949 ATGGCTTATGATGCAACTAATGG + Intergenic
1100530396 12:95456578-95456600 ATGGCTTAGGATGCATCTCAAGG + Intergenic
1100866947 12:98867188-98867210 ATGGGTTAGGATGAGTTTCCAGG + Intronic
1101704785 12:107211610-107211632 GTGGCTTAGGATGCATTTCAAGG - Intergenic
1101779570 12:107823478-107823500 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1104136754 12:125947687-125947709 ATGGCTGCAGATGCCTTTCATGG + Intergenic
1104306091 12:127612016-127612038 GTGGCTTAGGATATATTTCAAGG - Intergenic
1104484397 12:129137630-129137652 ATGGCTTATCATCCATTTCCTGG + Intronic
1105762388 13:23526601-23526623 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1106162596 13:27214478-27214500 ATGATTTAGGATGCATTTCAAGG - Intergenic
1107807969 13:44172515-44172537 GTGGCCTAGGATGCCTTTAAAGG + Intergenic
1108573341 13:51770953-51770975 ATTTCTTAGGATGAATTCCAAGG + Intronic
1108814744 13:54276931-54276953 TTAGCTTAAAATGCATTTCAAGG + Intergenic
1108848534 13:54702164-54702186 ATGACTTAGGATGCATTTCAAGG - Intergenic
1109424213 13:62150556-62150578 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1111372441 13:87335272-87335294 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1112519020 13:100080035-100080057 GTGGCTTAGGATGCGTTTCAAGG - Intergenic
1113059985 13:106312606-106312628 AGGTGTTAGGATTCATTTCACGG + Intergenic
1113204011 13:107895556-107895578 AAGGCTTAGGATGCATTTCAAGG + Intergenic
1113439442 13:110316329-110316351 ATGGCTTTTGATGCAGTCCAGGG - Intronic
1113551597 13:111197003-111197025 ATGGCTTAGGATGCATTTCAAGG + Intronic
1115285552 14:31710180-31710202 ATGGCTTAGGATGCATTTCAAGG + Intronic
1116234804 14:42266087-42266109 GTGGCTTAGTATGAATTTTAGGG + Intergenic
1116588181 14:46736740-46736762 ATTGCCTAGGTTGCTTTTCAGGG + Intergenic
1117334461 14:54745069-54745091 ATGGCTTGGGATGCGTGGCAGGG - Intronic
1120198698 14:81514756-81514778 ATGGCTTAGGATGCATTTCAAGG - Intronic
1120258826 14:82156425-82156447 AAGGCTTATGTAGCATTTCATGG + Intergenic
1120718183 14:87862740-87862762 ATTGCTTAGTAGGCATTTCTAGG - Intronic
1125820158 15:42622949-42622971 ATAGCTTAAGATGCAGATCAGGG + Intronic
1127127500 15:55826129-55826151 ACTGCATAGGATGCATTGCAGGG + Intergenic
1127560241 15:60129010-60129032 ATGACTTTGGAAGCATTTCGTGG + Intergenic
1131349181 15:91681263-91681285 AGGGCTTAGGAGGCTTTTCAGGG - Intergenic
1135339772 16:21635705-21635727 GTGGCTTAGGATGCATTTCAAGG + Intronic
1137528738 16:49262607-49262629 ATGGATTAGGATGCAGCGCAGGG - Intergenic
1138575238 16:57903540-57903562 TTGGATGGGGATGCATTTCAAGG + Intronic
1140056855 16:71532956-71532978 ATGTCTTAGGGAGCATTCCAGGG - Intronic
1145804012 17:27713568-27713590 ATGGCTTAGGATGCATGTCAAGG - Intergenic
1146150476 17:30464735-30464757 ATGGCTTAGGAGGGACTTCTTGG - Exonic
1146310413 17:31764230-31764252 ATGGCTTACAATGCATTTCAAGG - Intergenic
1149073800 17:52574927-52574949 ATGGCTTAGGATGCATTTCAGGG - Intergenic
1149209573 17:54287986-54288008 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1151567907 17:74910105-74910127 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1151638984 17:75375334-75375356 ATGAATTATGATGAATTTCATGG + Intronic
1152167792 17:78722103-78722125 AAGACTTAGCTTGCATTTCAAGG + Intronic
1153437954 18:5087205-5087227 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1155476216 18:26237871-26237893 GGGGCTTAGGATACATTTCAAGG + Intronic
1156067177 18:33157733-33157755 ATGGCTTTTTAGGCATTTCATGG + Intronic
1157858001 18:51118746-51118768 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1158917636 18:62151426-62151448 ATGGCATAGTATGCCTGTCAGGG + Intronic
1160040983 18:75345227-75345249 ATGACTTAGGATGCATGTAGGGG + Intergenic
1160298231 18:77656774-77656796 ATGGCTTGGGCTGCATTTAGGGG - Intergenic
1161598330 19:5164176-5164198 GTGGCTTAGGATGCATTTCAAGG + Intronic
1162107822 19:8381220-8381242 ATGGCCTAGGATGCATTTCAAGG - Intronic
1164993049 19:32698345-32698367 GTGGCTTAGGATGCATTTCAAGG + Intronic
1165846979 19:38824471-38824493 ACGGCTTAGGATGCATTTCAAGG - Intronic
1166192964 19:41187782-41187804 ATCACTTAAGATGCTTTTCAGGG - Intergenic
925542774 2:4984302-4984324 CTGGCTGAAGATGCATTTTAGGG - Intergenic
925949995 2:8900955-8900977 ATGGCTTAGGATGCATTTCAAGG + Intronic
928617731 2:33056235-33056257 ATAGCTTAGGATGCATTTCAAGG + Intronic
929330273 2:40673910-40673932 ATGGCTTAGGTTGCATTTCAAGG - Intergenic
929543973 2:42843756-42843778 ATGGGTGAGGATGGAATTCATGG + Intergenic
929580647 2:43079893-43079915 ATGTATTAGGGTGCATTCCAGGG - Intergenic
930038418 2:47102329-47102351 AAGGCTTAGGATGCATTTCAAGG - Intronic
930340108 2:50101897-50101919 TTCTCTTGGGATGCATTTCAAGG - Intronic
933044594 2:77519549-77519571 GTGGATGAAGATGCATTTCAAGG - Exonic
933342050 2:81037017-81037039 ATGGCTTAGCATGCATTTGAAGG - Intergenic
934069241 2:88368299-88368321 ATGTCTTAGATTGCATTTAAAGG - Intergenic
934867016 2:97822849-97822871 ATGGCTTAGGATGCATTTCAAGG - Intronic
935264052 2:101379776-101379798 ATGGCCTAGGAGGCCCTTCATGG - Intronic
935314674 2:101820186-101820208 ATTGCTCAGGAAGCCTTTCATGG + Intronic
937281302 2:120719251-120719273 CTGGTTTAGGATGCATTTCTTGG + Intergenic
937557695 2:123179873-123179895 TTGGCTTAGACTGCCTTTCAAGG - Intergenic
938806295 2:134809655-134809677 ACGGCTTAGGATGCATTTCAAGG + Intergenic
939851750 2:147313133-147313155 ATGGCTTGGGATGCATTTCAAGG - Intergenic
940168937 2:150805787-150805809 ATGGCTTAGCATGGATTGGATGG - Intergenic
941243311 2:163068507-163068529 ATGGCTTAGGATGCATTTTAAGG - Intergenic
941537653 2:166742412-166742434 ATGGCTTAGGATGCATTTCAAGG + Intergenic
943103175 2:183511194-183511216 ATGGCTTAGGATGCATTTCAAGG + Intergenic
943133644 2:183887186-183887208 AAGGCTTAGGATGCATTTCAAGG - Intergenic
944728888 2:202498663-202498685 ATGGCTTAGGATGCATTTCAAGG - Intronic
944951916 2:204761172-204761194 ATGGCCAAGGATGACTTTCATGG + Intronic
945108266 2:206337763-206337785 ATAGCTTAGAAAGTATTTCATGG + Intergenic
946207464 2:218120186-218120208 ATGGCTTAGGATGCATTTTAAGG + Intergenic
1169404342 20:5311115-5311137 ATGGATGAGTATGGATTTCAGGG + Intronic
1170312730 20:15010315-15010337 GTGGCTTAGCAGGCATTTTAAGG - Intronic
1171261404 20:23737676-23737698 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1171270535 20:23813567-23813589 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1172340542 20:34154180-34154202 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1177134958 21:17298539-17298561 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1184646093 22:45896288-45896310 ATGGCTGAGGATGCAGTTCTCGG - Intergenic
949449079 3:4165770-4165792 ATGGCTTAGGATGCATTTCAAGG + Intronic
949768067 3:7548773-7548795 ATGGCTTTGGTTGCAGTTCTGGG + Intronic
951020386 3:17776218-17776240 ATGGCTTAGGATGCATTTCAAGG - Intronic
951204251 3:19909469-19909491 ATGGCCTAGACTGCCTTTCAAGG - Intronic
951794602 3:26524289-26524311 ATGGCCTAGGCTGCCTTTCAAGG + Intergenic
952555155 3:34522552-34522574 GTGGCTTAAGATGCATTTCAAGG + Intergenic
952941061 3:38444700-38444722 GTGGCTTAGGATGCATTTCAAGG + Intergenic
952949287 3:38506412-38506434 ATTCCTTAGGATAAATTTCAAGG - Intronic
952993184 3:38850608-38850630 ATGGTCAAGGATGGATTTCATGG + Exonic
953146610 3:40282059-40282081 AGGGCTGGGGATGCATTTCGGGG - Intergenic
953623054 3:44549161-44549183 ATGGCTTAGGATGCATTTCAAGG + Intergenic
954232378 3:49227320-49227342 ATGGCTTAGGATGCATTTCAGGG + Intronic
954243404 3:49311714-49311736 ATGCCTTAGGTTGCTTCTCAAGG + Intronic
954598811 3:51851916-51851938 ATGGCTTAGGATGCATTTCAAGG - Intergenic
954729285 3:52644299-52644321 ACGGTTTATGTTGCATTTCAAGG - Intronic
956514540 3:70032659-70032681 ATGGCTTAGGATAAGTTTTATGG + Intergenic
956843073 3:73157751-73157773 GTGGCTTAGGATGCATTTCAAGG + Intergenic
958549324 3:95593737-95593759 ATGGCTTAAGATGCATTTCAAGG + Intergenic
958575913 3:95949828-95949850 ATGACTTAAGATGCATTTCAAGG + Intergenic
958601281 3:96299538-96299560 ATAGCTTAGGATGCATTTCAAGG - Intergenic
958681542 3:97338368-97338390 AGGGTTAAGGATGCATTTCAAGG - Intronic
960063577 3:113348277-113348299 GTTGCTTAGGATGCATTTCAAGG - Intronic
960608783 3:119535517-119535539 ATGGCTTAAGATGGCTTACAAGG - Intronic
961261553 3:125606116-125606138 ATGGCTTAAGATGCATTTCAAGG - Intergenic
963021146 3:140874099-140874121 ATGGCTTAGGATGCATTTCAAGG - Intergenic
963581466 3:147130966-147130988 ATAGCTTTGGAGGCATTTTAGGG - Intergenic
963696631 3:148572594-148572616 GTGGCTTAGAATGCATTTCAAGG - Intergenic
963992403 3:151669219-151669241 ATGGCTTAGAATGTATTTCAAGG + Intergenic
964064385 3:152561569-152561591 GTGGTTTATGATGCATTTCAAGG - Intergenic
964972131 3:162576278-162576300 ATGGCTTAGGATGCATTTCAAGG - Intergenic
965062633 3:163803338-163803360 ATGGCTTAGGATGCATTTCAAGG - Intergenic
965489224 3:169316393-169316415 ATTTCTCAGGATGCATTTGAGGG + Intronic
966026100 3:175284266-175284288 ATGGCTTAGGCTGCCTTTCTTGG + Intronic
966552930 3:181225422-181225444 TTGGCTTTGTATGAATTTCAGGG + Intergenic
966728645 3:183131855-183131877 ATGGCTTAGGATGTTATTCATGG - Intronic
967583508 3:191187194-191187216 ATGGCTTAGAATACATTTCAAGG - Intergenic
968139814 3:196246659-196246681 TTGGCTTAAGTTTCATTTCAGGG - Intronic
971281323 4:25244618-25244640 ATGGCTTAGGATGCATTTCAAGG + Intronic
971578362 4:28304772-28304794 ATGGCTTAGGATGCCTTTCAAGG - Intergenic
971934188 4:33126296-33126318 ATGTCTTAGTATGGATTGCAAGG + Intergenic
972133414 4:35863438-35863460 ATGGCTTAAGATGCATTTCAAGG + Intergenic
973045753 4:45533211-45533233 ATGGCTTAGGATGCATTTCAAGG - Intergenic
974187197 4:58459850-58459872 ATGGCTTAGGGTGCATTTCAAGG - Intergenic
974526440 4:63054607-63054629 ATGGCTTAGGATGCATTTCAAGG - Intergenic
974537018 4:63186389-63186411 GTGGCTTAGGATGCATTTCAAGG - Intergenic
974838963 4:67280541-67280563 ATGGCTTAGGATGCATTTCAAGG + Intergenic
975047877 4:69826596-69826618 ATGAGTTAGGATGCATTTCAAGG - Intronic
975282783 4:72581392-72581414 ATATCTTAGGATGAATTTCATGG + Intergenic
975595962 4:76048423-76048445 ATGGCTTAGGATGCATTTCAAGG + Intronic
975881881 4:78919580-78919602 AAGGCTTAAGGTTCATTTCAGGG + Exonic
976174432 4:82337276-82337298 ATGGCTTAGGATGCATTTCAAGG + Intergenic
976727846 4:88232197-88232219 TTGGCTTAAGAAGCTTTTCAAGG - Intergenic
977211947 4:94228579-94228601 ATGTCTTAGAATGCAAATCAGGG + Intronic
977883978 4:102237069-102237091 ATGGCTTGGGATGCATTTCAAGG - Intergenic
978747059 4:112207211-112207233 ATGGCTTAGGATGCACTTCAAGG - Intergenic
982701008 4:158659739-158659761 ATGGCTTAGGATGCATTTCAAGG - Intergenic
982877184 4:160664110-160664132 ATGGCTTAGGATGCATTTCAAGG - Intergenic
983835044 4:172375411-172375433 ATAGCTTTGGATGCATTTCAAGG + Intronic
984917330 4:184736206-184736228 ACGGCTTAGGATGCATTTCAAGG - Intergenic
985225691 4:187759487-187759509 ATGGCTTAGAATGCCCTTCATGG + Intergenic
987929776 5:24388942-24388964 ATGGCTTAGGATGCATTTCAAGG - Intergenic
988357695 5:30199386-30199408 GTGGCTTAGGATACATTTCAAGG - Intergenic
988592136 5:32558102-32558124 TTGGCTTAGGATGCATTTCAAGG + Intronic
988605613 5:32676222-32676244 TTGGCTTAGGATGCATTTCAAGG + Intergenic
989134872 5:38143824-38143846 ATTGCTTAGCTTGCATATCAAGG - Intergenic
989496124 5:42113075-42113097 ATGGCTTAGGATGCATTTCAAGG - Intergenic
989957230 5:50372100-50372122 ATGGCTTAGGATGCATTTCAAGG - Intergenic
989964483 5:50451822-50451844 ATGGCTTAGGATGCATTGCAAGG + Intergenic
990116617 5:52399064-52399086 ATGGCTTAGGATGCATTTCAAGG - Intergenic
990367990 5:55089416-55089438 GTGGCTTAGGATGCACTTCAAGG + Intergenic
992049246 5:72928073-72928095 ATGGCTTAGGATGCATTTCAAGG - Intergenic
992545649 5:77811774-77811796 ATGGCTTAGGATGCATTTCGAGG - Intronic
992704982 5:79381195-79381217 GTGGCTTAGGGTGCAGTTCGTGG - Intronic
994231859 5:97316503-97316525 ATGACTTAGGATGCATTTCAAGG + Intergenic
994682766 5:102909754-102909776 ATAGCTTAGCTTGCATATCATGG - Intronic
995583543 5:113624040-113624062 ATGGCTTAGGATGCATTTCACGG + Intergenic
995844781 5:116481838-116481860 ATGGCTTAGAATTCTTTTCATGG - Intronic
996099355 5:119431089-119431111 ATAGCTTAGGATGCATTTCAAGG + Intergenic
996342356 5:122452795-122452817 GTGGCTTAGTATGCACTTTAAGG - Intronic
996680255 5:126223062-126223084 ATGGCTTAGGACGCATTTCAAGG - Intergenic
997033539 5:130159819-130159841 ATTGCCTTGGATGCATTTCTTGG - Intronic
997072281 5:130635360-130635382 ATGGCTTAGGATGCATTTCAAGG - Intergenic
998111343 5:139505100-139505122 ATGACTGAGGATGCATTTCAAGG - Intergenic
998914940 5:147002909-147002931 ATGGCTTAGGATGCATTTCAAGG - Intronic
1000085107 5:157881784-157881806 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1002929966 6:1626673-1626695 ACGACATAGGATGCATTTCATGG + Intronic
1004531242 6:16457455-16457477 ATGGCTTAGGATGCGTTTCAAGG - Intronic
1004724163 6:18294996-18295018 AGGATTTAGGAAGCATTTCAAGG - Intergenic
1004812117 6:19272990-19273012 ATGATTTAGGATGCATTTCAAGG - Intergenic
1004917965 6:20349652-20349674 ATTCCTTAAGATGTATTTCAAGG + Intergenic
1007029900 6:38618171-38618193 GTGGCTTAGGATGCATTTCAAGG - Intronic
1008587126 6:52960284-52960306 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1009360147 6:62801741-62801763 AAGGCTAAGGAAGCGTTTCATGG + Intergenic
1009386060 6:63085029-63085051 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1009470679 6:64026389-64026411 ATGGCTTAGGATGCATTTCAAGG - Intronic
1009872651 6:69469904-69469926 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1010074822 6:71787328-71787350 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1010269707 6:73905646-73905668 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1011375169 6:86679622-86679644 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1012284765 6:97375402-97375424 ATTGCTTAGGTTGTCTTTCAGGG + Intergenic
1012605126 6:101148597-101148619 ATGCATTAGGATTCAATTCATGG + Intergenic
1012610237 6:101209275-101209297 ATTGCTTAGGAAGCATATAACGG + Intergenic
1013907977 6:115239388-115239410 ATGGCTTAGGATACATTTCAAGG + Intergenic
1013977291 6:116092857-116092879 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1014578092 6:123099358-123099380 ATAGCTTAGGAGGCAAGTCAGGG - Intergenic
1016183900 6:141177927-141177949 ATGTCTTAGGATACATTTCAAGG - Intergenic
1021356702 7:19659263-19659285 ATGGCTTAGGATGCACTTCAAGG + Intergenic
1021756851 7:23860313-23860335 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1022496461 7:30855980-30856002 ATGGCTTGGTATACATTTCCAGG - Intronic
1023078081 7:36502996-36503018 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1023151174 7:37202842-37202864 ATGGCTTAGGATGTATTTCAAGG + Intronic
1024735155 7:52296581-52296603 GTGGCTTAGGATGCATTTCAAGG - Intergenic
1024870914 7:53961001-53961023 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1026385857 7:69847032-69847054 ATGCCTTAAGGTGCATTTCAAGG - Intronic
1027790995 7:82638854-82638876 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1027973516 7:85118881-85118903 ATTGCTTAGGTTGTCTTTCAGGG + Intronic
1028495351 7:91454561-91454583 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1029088302 7:98028606-98028628 AAGGATTAGGATGGATCTCAAGG - Intergenic
1030420389 7:109300960-109300982 ATGGCTTACCATGCATTTCAAGG - Intergenic
1030968372 7:116022351-116022373 ATGCATTAGACTGCATTTCAAGG - Intronic
1031731644 7:125309588-125309610 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1033759384 7:144423156-144423178 ATAGCTTAGGATGCATTTCAAGG + Intergenic
1034300917 7:150014621-150014643 ATGGCTCAGTTTGCATTTCAAGG - Intergenic
1034529928 7:151689391-151689413 ATGGCTTGGGATACACTTCCAGG - Intronic
1034580111 7:152034516-152034538 GTGGCTTAGGATGCATTTCAAGG + Intronic
1034805134 7:154082681-154082703 ATGGCTCAGTTTGCATTTCAAGG + Intronic
1035520066 8:268479-268501 ATGGGTTAGGATACTTTTCAAGG + Intergenic
1035928100 8:3751172-3751194 ATGCATTAGGAAACATTTCAAGG - Intronic
1036585077 8:10116207-10116229 ATGGGTTAGGATGCACTCAACGG - Intronic
1037656433 8:20888039-20888061 ATGGCTTTGGATTCAGTTCCAGG - Intergenic
1038638655 8:29306743-29306765 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1038788635 8:30646542-30646564 AGTGCTTAGGATACATTTCCAGG - Intronic
1039693310 8:39883727-39883749 ATGACTGAGGATGCATTTCAAGG + Intergenic
1039999812 8:42566386-42566408 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1040064979 8:43138412-43138434 CTGGCTTAGGATTGGTTTCAGGG + Intergenic
1040527079 8:48234809-48234831 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1040668003 8:49655240-49655262 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1040796932 8:51297512-51297534 ATGGCTTAGGATGCATTTCATGG + Intergenic
1040965190 8:53075332-53075354 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1041669068 8:60475132-60475154 ATGTCTTAGGTTGGATTTCCTGG - Intergenic
1042919478 8:73907778-73907800 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1043256928 8:78149379-78149401 ATTGCTTAGGATGCATTTCAAGG - Intergenic
1044456759 8:92399128-92399150 ATGGCTTAGGATGCATTAAAGGG + Intergenic
1045549136 8:103154561-103154583 ATGTCTTAGTATGGAATTCAAGG + Intronic
1045745472 8:105414654-105414676 GTGGCTATGGATGCATTTCAGGG + Intronic
1045858413 8:106790323-106790345 ATTGTTTAGGATGCATTTCATGG - Intergenic
1048518050 8:135128426-135128448 AAGGCTTGGAATGCATCTCAGGG + Intergenic
1050092909 9:2033533-2033555 ATGGATAAGCATGCAATTCAAGG - Intronic
1050195733 9:3081621-3081643 ATGACTTTGGAGGCATTTCCAGG + Intergenic
1050909016 9:11042613-11042635 ATGGCTTTGGATCCATTTCAAGG - Intergenic
1051889631 9:21928720-21928742 ATTATTGAGGATGCATTTCAGGG - Intronic
1051935134 9:22436306-22436328 AAGGCTTAGGATGCATTTCAAGG - Intergenic
1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG + Intergenic
1053623003 9:39839979-39840001 ATGGCTTAGGAGACTTTTTAAGG - Intergenic
1053881870 9:42603248-42603270 ATGGCTTAGGAGACTTTTTAAGG + Intergenic
1053890802 9:42691041-42691063 ATGGCTTAGGAGACTTTTTAAGG - Intergenic
1054220894 9:62410713-62410735 ATGGCTTAGGAGACTTTTTAAGG + Intergenic
1054229820 9:62498459-62498481 ATGGCTTAGGAGACTTTTTAAGG - Intergenic
1055458415 9:76493980-76494002 GTGGCTTAGGATGCATTTCAAGG + Intronic
1056392925 9:86155511-86155533 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1062120834 9:134833291-134833313 ATGGCTCAGGATGCCCTGCACGG + Intronic
1062143686 9:134976372-134976394 ATGGCTTTTGGGGCATTTCAGGG + Intergenic
1062151732 9:135022793-135022815 TTGGCTTACCCTGCATTTCAGGG + Intergenic
1188136386 X:26499232-26499254 GTGGCTTAGGATGTATCTCAAGG - Intergenic
1190541317 X:51481390-51481412 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1191206074 X:57835240-57835262 ATGGCTTAGGAAGCATTTCAAGG + Intergenic
1191591928 X:62895530-62895552 ATTGCTTAGGTTGTCTTTCAGGG + Intergenic
1192482904 X:71500430-71500452 ATGGCTTAGGATGCATTTCAAGG + Intronic
1192870155 X:75176989-75177011 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1192949361 X:76000193-76000215 ATGGCTTAGGTTGTCTTCCAGGG + Intergenic
1193205252 X:78740109-78740131 AAAGCTTAGAAGGCATTTCAGGG - Intergenic
1193585976 X:83321761-83321783 ATTGCTTAGGTTGTCTTTCAGGG - Intergenic
1193821568 X:86171439-86171461 ATGGCCTAGATTGCCTTTCAAGG + Intronic
1193912112 X:87318059-87318081 ATGGCCTAGACTGCCTTTCAAGG + Intergenic
1195104280 X:101588384-101588406 ATTGCCTAGGTTGTATTTCAGGG + Intergenic
1196127490 X:112115032-112115054 ATGGCATAGGATGCATTTCAAGG + Intergenic
1196419526 X:115507863-115507885 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1196488849 X:116245263-116245285 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1196662088 X:118280156-118280178 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1196785887 X:119421142-119421164 ATGGCTCGGAATGCATTTGAAGG - Intronic
1197513272 X:127396785-127396807 ATGGCTTAAGATGCATTTCAAGG - Intergenic
1197665071 X:129214566-129214588 ATGGATTAGGTTACACTTCAGGG - Intergenic
1199261388 X:145779600-145779622 AAGGCCTTGGAAGCATTTCAGGG + Intergenic
1199832553 X:151560452-151560474 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1200776089 Y:7171554-7171576 AGGGCTTAGGATGCATTTCAGGG - Intergenic
1200880930 Y:8210625-8210647 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1200959199 Y:8981749-8981771 ATGGCTAAGGATATATTTCAAGG - Intergenic
1200966642 Y:9045083-9045105 GTGGCTTAAGATGAATTCCAAGG - Intergenic
1201272053 Y:12264937-12264959 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1201312185 Y:12606940-12606962 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1201407635 Y:13664585-13664607 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1201413686 Y:13726619-13726641 TTGGCTTAGGATTGATTTCGTGG - Intergenic
1201429560 Y:13890713-13890735 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1201454992 Y:14160009-14160031 ATGGCTTACAATGAATTTCAAGG - Intergenic
1201468701 Y:14311999-14312021 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1201487439 Y:14508083-14508105 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1201496544 Y:14595637-14595659 ATGGCTTAGGATGCATTTCAAGG + Intronic
1201516099 Y:14819943-14819965 ATGGCTTAGGATGCATTTCAAGG + Intronic
1201555600 Y:15262487-15262509 ATGGCTTAGAATGCATTTCAAGG - Intergenic
1201604589 Y:15771217-15771239 GTGGCTTAGGATGCATTTCAAGG - Intergenic
1201631129 Y:16073018-16073040 GTGGCTTAGGATGCATTTCAAGG - Intergenic
1201649026 Y:16265139-16265161 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1201653783 Y:16320161-16320183 ATGGCTTAGGATGCATTTCAAGG - Intergenic
1201729719 Y:17190883-17190905 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1201744118 Y:17352180-17352202 ATGGCTTAGGATGCCTTTCAAGG + Intergenic
1201908336 Y:19107494-19107516 TAGGCTTAGGATACATTTCAAGG + Intergenic
1201910982 Y:19133286-19133308 ATGGCTTATAACGCATTTCAAGG - Intergenic
1201989649 Y:20009723-20009745 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1202090002 Y:21179291-21179313 GTGGCTTAGGATGCATTTCAAGG + Intergenic
1202146817 Y:21807093-21807115 GTGGCTTAGGATGCATTCCAAGG + Intergenic
1202192748 Y:22261092-22261114 ATGGCTTAGGATGCATTTCAAGG + Intergenic
1202242747 Y:22787917-22787939 TTGGCTTAGGATGCATTTCAAGG - Intergenic
1202272202 Y:23083167-23083189 ATGGTTTAGCATGCATTTCAAGG + Intergenic
1202293824 Y:23337515-23337537 ATGGTTTAGCATGCATTTCAAGG - Intergenic
1202395734 Y:24421667-24421689 TTGGCTTAGGATGCATTTCAAGG - Intergenic
1202425199 Y:24716911-24716933 ATGGTTTAGCATGCATTTCAAGG + Intergenic
1202445590 Y:24953174-24953196 ATGGTTTAGCATGCATTTCAAGG - Intergenic
1202475051 Y:25248425-25248447 TTGGCTTAGGATGCATTTCAAGG + Intergenic