ID: 1099576953

View in Genome Browser
Species Human (GRCh38)
Location 12:84393847-84393869
Sequence TGGCTTAGGATGCATTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 152, 1: 61, 2: 27, 3: 20, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576944_1099576953 17 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576953 12:84393847-84393869 TGGCTTAGGATGCATTTCAAGGG 0: 152
1: 61
2: 27
3: 20
4: 193
1099576946_1099576953 14 Left 1099576946 12:84393810-84393832 CCTCTTTTTCAGGGTTTTCAGGT No data
Right 1099576953 12:84393847-84393869 TGGCTTAGGATGCATTTCAAGGG 0: 152
1: 61
2: 27
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576953 Original CRISPR TGGCTTAGGATGCATTTCAA GGG Intergenic
902979583 1:20113398-20113420 TGGCTCAGGGTGAATTACAAGGG - Exonic
903620576 1:24695238-24695260 TTGCTTAGGCTGGAGTTCAATGG - Intergenic
906628945 1:47348653-47348675 TGACATAGGATACATTCCAACGG - Intronic
906766562 1:48439712-48439734 TGGCTTAGGATGCATTTCAAGGG - Intronic
906766570 1:48439759-48439781 TGGCTTAGGATGCATTTCAAGGG - Intronic
907537411 1:55177049-55177071 TTGCTTAGGCTGCAGTGCAATGG - Intronic
907722381 1:56984058-56984080 CTGCTTAAGATGCATTTCAAAGG + Intergenic
907842245 1:58169436-58169458 TGGCTTAGGATGCATTTTAAGGG - Intronic
908300304 1:62756031-62756053 TGGCTGAGGATGCATTTCAAGGG - Intergenic
908659857 1:66424245-66424267 AGGCTTAGGATGCATTTCAAGGG + Intergenic
908973956 1:69874198-69874220 TGGCTTTTCATGCAGTTCAATGG + Intronic
909359519 1:74744441-74744463 TGGCTTAGGATGCATTTCAAGGG + Intronic
909999003 1:82319256-82319278 TGGCTTAGGACCCACCTCAATGG + Intergenic
910397608 1:86807921-86807943 TGTCTTACAATGCATTTCAAGGG + Intergenic
911129882 1:94377047-94377069 TGGCTTAGGATGCATTTCAAGGG + Intergenic
911298859 1:96149681-96149703 TGGCTTAGGATGCATTTCAAGGG - Intergenic
911751307 1:101500643-101500665 TGGCTTAGGATGCATTTCAAGGG - Intergenic
911845731 1:102748335-102748357 TGGCTTAGGATGCATTTCAAGGG + Intergenic
912755064 1:112317407-112317429 GGGCTTATGATTTATTTCAAAGG - Intergenic
912870642 1:113301884-113301906 TTGCTTATGATTCATTTTAATGG + Intergenic
913382512 1:118227308-118227330 TGGCTTAGGATGCATTTCAAGGG - Intergenic
913469400 1:119174069-119174091 TGGCTTAGGATGCATTTCAAGGG - Intergenic
915260454 1:154673259-154673281 TGGCTTAGGATGCATTTCAAGGG - Intergenic
915502110 1:156326608-156326630 TGGCTTAGGCTGGAGTGCAATGG - Intronic
916083515 1:161251900-161251922 TGGCTTAGGATGCATTTCAAGGG - Intergenic
916114326 1:161474337-161474359 TGGCTTAGGATGCGTTTCAAGGG - Intergenic
916939413 1:169663780-169663802 TGGCTTAGGATGCATTTCAAGGG - Intronic
917086023 1:171306620-171306642 TGGCTTAGGATGCATTTCAAGGG - Intergenic
917279777 1:173369620-173369642 TGGCTTAGGATGCATTTCAAGGG - Intergenic
917281041 1:173378466-173378488 TGGCTTAGAATACATTTCAGGGG - Intergenic
917445916 1:175105746-175105768 TGGCTTAGGATGCATTTCAAGGG + Intronic
917676169 1:177321388-177321410 TGGCTTAGGATGCATTTCAAGGG - Intergenic
918175033 1:182036055-182036077 GGGTTCAGGATGCATTTGAAAGG + Intergenic
918470355 1:184866380-184866402 TGGCTTAGGATTTAGTTCTAAGG + Intronic
918750281 1:188261960-188261982 TGGCTTCAGATGCATTTCAAGGG + Intergenic
919084258 1:192902474-192902496 TGGTATTGGATGCATTTAAATGG - Intergenic
919206183 1:194423767-194423789 TGGCTTAGGATGCATTTCAAGGG - Intergenic
919280351 1:195482154-195482176 GGGTTCAGGATGCATTTGAAAGG + Intergenic
919392126 1:196999607-196999629 TTGCTTAGGTTGCATCTCATAGG - Intronic
919558550 1:199092029-199092051 CGGCTTAGGATGCATTTCAAGGG - Intergenic
920453482 1:206078862-206078884 TGGCTTAGGGTGCAGTCCAGCGG - Intronic
921019587 1:211223951-211223973 TGGCTTAGGGTGCATTTCAATGG - Intergenic
921809448 1:219496193-219496215 TGGCTTAGCATTCTTTTTAATGG - Intergenic
923793695 1:237133348-237133370 TGGTTTAGAATGCATTTCCTAGG + Intronic
924138562 1:240998276-240998298 TGGCTTGGTATGCATTTCGTTGG + Intronic
1063321813 10:5058467-5058489 TGGCTTAGGATGCATTCCAAGGG + Intronic
1063859197 10:10289947-10289969 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1064603677 10:17017075-17017097 TGGCTTAGGACACATTTCAAGGG + Intronic
1065082301 10:22140566-22140588 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1066614680 10:37282861-37282883 TGGCTTAGGATGCATTTCAAAGG + Intronic
1068240546 10:54297244-54297266 TGGCTTAGGATGCATTTCAAGGG - Intronic
1068500205 10:57834450-57834472 TGACTTAGGATGCATTTCAAGGG - Intergenic
1069365189 10:67688664-67688686 TGGCTTAGGATGCATTTCAAGGG + Intronic
1071765611 10:88661235-88661257 TGGCCTGGAATGCATTTCACTGG + Intergenic
1071834754 10:89408134-89408156 TGGCTTAGGATGCATTTCAAGGG - Intronic
1072371755 10:94771607-94771629 TGGCTTAGGATGCATTTCAAGGG + Intronic
1074612933 10:115038814-115038836 TGGCTTAGGATACATTTCAAGGG - Intergenic
1074742742 10:116500630-116500652 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1075146236 10:119885285-119885307 TGGCTTAGGATGCATTTCAAGGG - Intronic
1075601886 10:123775540-123775562 TGGCTAAGTGTGCATCTCAAGGG - Intronic
1078186943 11:9060272-9060294 TTGCTTATGATTCATATCAATGG - Intronic
1079731327 11:23939819-23939841 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1079811760 11:25005541-25005563 TGACTTAGGATGCATTTCCAGGG + Intronic
1080941367 11:36922010-36922032 GGGTTTAGGATGCATTTGAAAGG + Intergenic
1081033326 11:38113255-38113277 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1081145904 11:39562458-39562480 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1081154219 11:39669086-39669108 TGGCTTATGATACAATTCCAGGG - Intergenic
1081421321 11:42876735-42876757 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1082747832 11:56985213-56985235 GGGTTCAGGATGCATTTGAAAGG + Intergenic
1082906231 11:58310921-58310943 TGGCTTAGAATGCATTTCAAGGG + Intergenic
1082944306 11:58741509-58741531 GGACTCAGGATGCATTTGAAAGG - Intergenic
1083125882 11:60565245-60565267 AGGTTCAGGATGCATTTGAAAGG + Intergenic
1084210894 11:67621791-67621813 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1086097653 11:83066847-83066869 TGGCCTAGAATACATTTTAATGG + Intronic
1086201807 11:84212608-84212630 TGGCTAATGATGCTTTTCTAAGG + Intronic
1086317289 11:85608248-85608270 TGGCTTAGGATGCATTTCAAGGG - Intronic
1087074908 11:94119940-94119962 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1087319165 11:96638152-96638174 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1087459092 11:98423236-98423258 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1087683431 11:101238907-101238929 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1088492447 11:110401142-110401164 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1088569637 11:111210475-111210497 TGTTTTATGATGCATATCAAGGG + Intergenic
1091574008 12:1715411-1715433 TGGCTTAGGATGCATTTCAAGGG + Intronic
1092472204 12:8790030-8790052 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1094320059 12:29173658-29173680 TAGCTTAGGATGCATTTCAAGGG + Intronic
1094338203 12:29383997-29384019 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1097428204 12:59472625-59472647 TGGCTTAGGATGCATTTTAAGGG - Intergenic
1097456064 12:59799993-59800015 TGTCTTATGCTGGATTTCAAAGG - Intergenic
1098064571 12:66600050-66600072 TGGCTCAGGCTCCTTTTCAAAGG - Intronic
1098436778 12:70476308-70476330 TGGTTCAGCATGCATTTGAAAGG - Intergenic
1098787499 12:74778652-74778674 TGGCATAGGATAAATTTCAATGG - Intergenic
1099376162 12:81898189-81898211 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1099414833 12:82372700-82372722 TGGCTTAGGATGCATTTCAAGGG + Intronic
1099534629 12:83828573-83828595 GGGTTCAGGATGCATTTGAAAGG + Intergenic
1099576953 12:84393847-84393869 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1100050863 12:90446617-90446639 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1100092061 12:90984406-90984428 TGGCTTAGGATGCATTTTAAGGG - Intronic
1100209696 12:92388347-92388369 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1100472781 12:94908599-94908621 TGGCTCAGGAGGCATTTTGATGG - Intronic
1100530397 12:95456579-95456601 TGGCTTAGGATGCATCTCAAGGG + Intergenic
1100677435 12:96882744-96882766 TGGCTAATGATGCATTTCTCAGG - Intergenic
1101704784 12:107211609-107211631 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1101779569 12:107823477-107823499 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1104306090 12:127612015-127612037 TGGCTTAGGATATATTTCAAGGG - Intergenic
1104767009 12:131336613-131336635 TGGCTTAGGATGCATTTCAAAGG - Intergenic
1105762387 13:23526600-23526622 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1106162595 13:27214477-27214499 TGATTTAGGATGCATTTCAAGGG - Intergenic
1107218342 13:37949089-37949111 TGTCTTATCATGCCTTTCAATGG + Intergenic
1108636907 13:52344287-52344309 ATGCTTAGGATGAGTTTCAAGGG + Intergenic
1108848533 13:54702163-54702185 TGACTTAGGATGCATTTCAAGGG - Intergenic
1108904785 13:55454869-55454891 TGATTCTGGATGCATTTCAAAGG + Intergenic
1109424212 13:62150555-62150577 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1109500943 13:63235637-63235659 TGGATTAGGATGCATTTCAAAGG - Intergenic
1109865743 13:68260822-68260844 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1110990609 13:82038715-82038737 GGGTTCAGGATGCATTTGAAAGG + Intergenic
1111132926 13:83999691-83999713 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1111275157 13:85937822-85937844 TGATTTAGGATGCACTTCAGAGG - Intergenic
1111372440 13:87335271-87335293 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1111786554 13:92794457-92794479 TGTCTTATGCTGGATTTCAAAGG - Intronic
1112519019 13:100080034-100080056 TGGCTTAGGATGCGTTTCAAGGG - Intergenic
1113204012 13:107895557-107895579 AGGCTTAGGATGCATTTCAAGGG + Intergenic
1113356242 13:109582997-109583019 TTGCTTAGGCTGCAGTGCAATGG - Intergenic
1113551598 13:111197004-111197026 TGGCTTAGGATGCATTTCAAGGG + Intronic
1114301188 14:21379843-21379865 TGGCTGAGGCTGGATTGCAATGG - Intronic
1115285553 14:31710181-31710203 TGGCTTAGGATGCATTTCAAGGG + Intronic
1115437862 14:33396706-33396728 TTGCTTAGGATACAGTTGAAAGG + Intronic
1116389954 14:44380141-44380163 GGGTTCAGGATGCATTTGAAAGG + Intergenic
1116614055 14:47111269-47111291 TGGCTTAAGATGAATGTAAAAGG + Intronic
1116798120 14:49413455-49413477 TTGCTGAAGATGCATTTCCAGGG + Intergenic
1118550058 14:66940283-66940305 TGGTTCAGGATGCAATTGAAAGG + Intronic
1119989908 14:79184689-79184711 TGGCTGAGGATACGTATCAAGGG + Intronic
1120162190 14:81157907-81157929 TTGCTTAGGATAGATTTCTATGG - Intergenic
1120198697 14:81514755-81514777 TGGCTTAGGATGCATTTCAAGGG - Intronic
1123710400 15:22982325-22982347 TTGCTTAGGCTGGAGTTCAATGG - Intergenic
1126928247 15:53615860-53615882 TGGCTTAGGCTGCATTTTTTTGG + Exonic
1130444544 15:83988229-83988251 TGGCTAAGGCTGCTTTGCAATGG - Intronic
1130931756 15:88433633-88433655 TGGCTTAGGATGCCATCCTATGG + Intergenic
1131349180 15:91681262-91681284 GGGCTTAGGAGGCTTTTCAGGGG - Intergenic
1132301678 15:100779939-100779961 TGGACTAGGATGCATTTCTGTGG + Intergenic
1134768475 16:16783127-16783149 TGAATTAGGTTGTATTTCAAAGG - Intergenic
1135339773 16:21635706-21635728 TGGCTTAGGATGCATTTCAAGGG + Intronic
1138011359 16:53383672-53383694 TGGCCTAGGCTGCAGTGCAATGG + Intergenic
1145700132 17:26823189-26823211 TGGAATAGAATGCAATTCAATGG + Intergenic
1145804011 17:27713567-27713589 TGGCTTAGGATGCATGTCAAGGG - Intergenic
1146039141 17:29434363-29434385 AGGTTCAGGATGCATTTGAAAGG + Intronic
1146310412 17:31764229-31764251 TGGCTTACAATGCATTTCAAGGG - Intergenic
1149073799 17:52574926-52574948 TGGCTTAGGATGCATTTCAGGGG - Intergenic
1149209572 17:54287985-54288007 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1149821335 17:59780946-59780968 TGGCTTATGATAGATTTCAGTGG + Intronic
1151459038 17:74243874-74243896 TGCCTTTGGATCCATTGCAAGGG + Intronic
1151567906 17:74910104-74910126 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1153437953 18:5087204-5087226 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1155465250 18:26127617-26127639 TGGGTTAGGAAGGTTTTCAAAGG + Intergenic
1155476217 18:26237872-26237894 GGGCTTAGGATACATTTCAAGGG + Intronic
1156123576 18:33875431-33875453 TGGCTAATGATGGATTTGAAGGG + Intronic
1157255671 18:46136740-46136762 TTGCTTAGGCTGGATTGCAATGG + Intergenic
1157822131 18:50779760-50779782 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1157858002 18:51118747-51118769 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1158151882 18:54382984-54383006 GAGCTCAGGATGCATTTGAAAGG + Intronic
1160079521 18:75712088-75712110 TGGCACAGGATGCATTTGAAAGG + Intergenic
1162107821 19:8381219-8381241 TGGCCTAGGATGCATTTCAAGGG - Intronic
1164993050 19:32698346-32698368 TGGCTTAGGATGCATTTCAAGGG + Intronic
1165846978 19:38824470-38824492 CGGCTTAGGATGCATTTCAAGGG - Intronic
925949996 2:8900956-8900978 TGGCTTAGGATGCATTTCAAGGG + Intronic
926192937 2:10741948-10741970 TGGCTTAGGCTGGAGTGCAATGG + Intronic
928617732 2:33056236-33056258 TAGCTTAGGATGCATTTCAAGGG + Intronic
928993318 2:37258992-37259014 TGGGTTATGATCCATTTCATAGG + Intronic
929330272 2:40673909-40673931 TGGCTTAGGTTGCATTTCAAGGG - Intergenic
929603732 2:43221043-43221065 TAGGTTAAGCTGCATTTCAAAGG - Intergenic
930038417 2:47102328-47102350 AGGCTTAGGATGCATTTCAAGGG - Intronic
930389842 2:50746761-50746783 GAAATTAGGATGCATTTCAAGGG + Intronic
931376357 2:61711975-61711997 GGGATGAGGATGCATTTCACTGG - Intergenic
931540375 2:63323994-63324016 TGGCTTAGGATGCATTTCAAAGG - Intronic
933044593 2:77519548-77519570 TGGATGAAGATGCATTTCAAGGG - Exonic
933342049 2:81037016-81037038 TGGCTTAGCATGCATTTGAAGGG - Intergenic
933569808 2:83996422-83996444 TGGCTTCAGATGCAAATCAAAGG - Intergenic
933820956 2:86111782-86111804 TGCCTTAGGCTGCAGTGCAATGG + Intronic
934867015 2:97822848-97822870 TGGCTTAGGATGCATTTCAAGGG - Intronic
934928391 2:98398209-98398231 TGCCTTGGGATGCAATTCCAAGG - Exonic
937643855 2:124244151-124244173 TGGGTTGGGATGTATTTCGAGGG + Intronic
937787420 2:125918404-125918426 TGGAGTTGGAAGCATTTCAAGGG + Intergenic
939792289 2:146592769-146592791 TGGTTTAGTATTAATTTCAAAGG + Intergenic
939851749 2:147313132-147313154 TGGCTTGGGATGCATTTCAAGGG - Intergenic
941243310 2:163068506-163068528 TGGCTTAGGATGCATTTTAAGGG - Intergenic
941537654 2:166742413-166742435 TGGCTTAGGATGCATTTCAAGGG + Intergenic
942951455 2:181727152-181727174 TGGCTTAGGAGCCATTTGAATGG + Intergenic
943103176 2:183511195-183511217 TGGCTTAGGATGCATTTCAAGGG + Intergenic
943133643 2:183887185-183887207 AGGCTTAGGATGCATTTCAAGGG - Intergenic
944145823 2:196506131-196506153 TGACTTAGAATGCATTTTTAAGG - Intronic
944348965 2:198704367-198704389 TGGCTTTGGAGGCGTTTGAAAGG - Intergenic
944728887 2:202498662-202498684 TGGCTTAGGATGCATTTCAAGGG - Intronic
946297246 2:218794807-218794829 GGGTTCAGGATGCATTTGAAAGG + Intronic
946983198 2:225241318-225241340 TGGCTTGGCATGCACTTCAGAGG + Intergenic
1170523994 20:17218409-17218431 TGGCTCAGGAACCATTTTAAAGG - Intergenic
1171261403 20:23737675-23737697 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1171270534 20:23813566-23813588 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1171925684 20:31186725-31186747 TGGAATGGAATGCATTTCAATGG + Intergenic
1172340541 20:34154179-34154201 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1175039172 20:56029584-56029606 TGGTTTAGGATGACTTTAAATGG + Intergenic
1177134957 21:17298538-17298560 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1177383119 21:20371211-20371233 TGGATTAGGATGCATCTTAATGG - Intergenic
1177415323 21:20785552-20785574 TGGATTAGGCTGGATTTCACTGG - Intergenic
1177543044 21:22520506-22520528 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1178748325 21:35275164-35275186 TGGGTTAAGGTGCTTTTCAAGGG - Intronic
1179956795 21:44745264-44745286 GGGGTCAGGATGCATTTAAAAGG - Intergenic
1182715864 22:32355937-32355959 TGGCTCAGGATGCTTGTGAAAGG - Intronic
1203308978 22_KI270736v1_random:129272-129294 TGGAGTAGAATGCATTTCAATGG + Intergenic
949449080 3:4165771-4165793 TGGCTTAGGATGCATTTCAAGGG + Intronic
951020385 3:17776217-17776239 TGGCTTAGGATGCATTTCAAGGG - Intronic
952555156 3:34522553-34522575 TGGCTTAAGATGCATTTCAAGGG + Intergenic
953309631 3:41864035-41864057 TGGCCTAGACTGCCTTTCAAAGG + Intronic
953623055 3:44549162-44549184 TGGCTTAGGATGCATTTCAAGGG + Intergenic
954598810 3:51851915-51851937 TGGCTTAGGATGCATTTCAAGGG - Intergenic
955613297 3:60780179-60780201 AGGTTCAGGATGCATTTGAAAGG - Intronic
955715813 3:61828658-61828680 TGGCGTCGGATGCATTGGAAAGG + Intronic
956843074 3:73157752-73157774 TGGCTTAGGATGCATTTCAAGGG + Intergenic
957288615 3:78248840-78248862 GGGTTCAGGATGCATTTGAAAGG - Intergenic
957574534 3:81990751-81990773 GGGTTCAGGATGCATTTGAAAGG - Intergenic
958549325 3:95593738-95593760 TGGCTTAAGATGCATTTCAAGGG + Intergenic
958575914 3:95949829-95949851 TGACTTAAGATGCATTTCAAGGG + Intergenic
958601280 3:96299537-96299559 TAGCTTAGGATGCATTTCAAGGG - Intergenic
960044508 3:113183829-113183851 TGGCTGAGGAAGCACTGCAAAGG - Intergenic
960063576 3:113348276-113348298 TTGCTTAGGATGCATTTCAAGGG - Intronic
961261552 3:125606115-125606137 TGGCTTAAGATGCATTTCAAGGG - Intergenic
962217443 3:133534895-133534917 TTGCTTAGGCTGGAGTTCAATGG + Intergenic
962645470 3:137434580-137434602 TGTCTTATGCTGCTTTTCAAAGG - Intergenic
963021145 3:140874098-140874120 TGGCTTAGGATGCATTTCAAGGG - Intergenic
963434065 3:145245221-145245243 GGGTTCAGGATGCATTTGAAAGG + Intergenic
963696630 3:148572593-148572615 TGGCTTAGAATGCATTTCAAGGG - Intergenic
964064384 3:152561568-152561590 TGGTTTATGATGCATTTCAAGGG - Intergenic
964304340 3:155324947-155324969 GGGTTCAGGATGCATTTGAAAGG - Intergenic
964972130 3:162576277-162576299 TGGCTTAGGATGCATTTCAAGGG - Intergenic
964980291 3:162669778-162669800 AGGTTCAGGATGCATTTGAAAGG - Intergenic
965038239 3:163470589-163470611 TGTCTTGGGCTGCTTTTCAAAGG + Intergenic
965043460 3:163542396-163542418 TGACTTAAGCAGCATTTCAAAGG + Intergenic
965062632 3:163803337-163803359 TGGCTTAGGATGCATTTCAAGGG - Intergenic
966268674 3:178078937-178078959 AGGCTGAGGAAGCATTGCAAGGG - Intergenic
967531131 3:190549880-190549902 GGGTTCAGGATGCATTTAAAGGG + Intronic
967583507 3:191187193-191187215 TGGCTTAGAATACATTTCAAGGG - Intergenic
969660644 4:8525512-8525534 TGGAGGAAGATGCATTTCAAAGG + Intergenic
969757307 4:9158358-9158380 TGGCCTAGGATGGATTTTAAAGG + Intergenic
970635965 4:18009786-18009808 TGCCTTAGCATGCCTTCCAATGG + Intronic
971281324 4:25244619-25244641 TGGCTTAGGATGCATTTCAAGGG + Intronic
971578361 4:28304771-28304793 TGGCTTAGGATGCCTTTCAAGGG - Intergenic
971896377 4:32602012-32602034 TGGTTTAGGTTGCATTACACAGG - Intergenic
972133415 4:35863439-35863461 TGGCTTAAGATGCATTTCAAGGG + Intergenic
973045752 4:45533210-45533232 TGGCTTAGGATGCATTTCAAGGG - Intergenic
973351858 4:49107553-49107575 TGGAATAGGATGGAATTCAATGG - Intergenic
973816460 4:54623943-54623965 TGACTAAGGATGCATTTATAAGG - Intergenic
974187196 4:58459849-58459871 TGGCTTAGGGTGCATTTCAAGGG - Intergenic
974526439 4:63054606-63054628 TGGCTTAGGATGCATTTCAAGGG - Intergenic
974537017 4:63186388-63186410 TGGCTTAGGATGCATTTCAAGGG - Intergenic
975047876 4:69826595-69826617 TGAGTTAGGATGCATTTCAAGGG - Intronic
975595963 4:76048424-76048446 TGGCTTAGGATGCATTTCAAGGG + Intronic
976174433 4:82337277-82337299 TGGCTTAGGATGCATTTCAAGGG + Intergenic
976345324 4:83993471-83993493 TGGTTCAGGATGCATTTGAAAGG - Intergenic
977835036 4:101636512-101636534 TGGCTTAGGATGCATTTCAATGG + Intronic
977883977 4:102237068-102237090 TGGCTTGGGATGCATTTCAAGGG - Intergenic
979104599 4:116667888-116667910 TAGTTCAGGATGCATTTGAAAGG - Intergenic
979159488 4:117441362-117441384 TGGCTGAGGATGAATTTTTAAGG - Intergenic
979183877 4:117763350-117763372 TTCCTTACGATGCAGTTCAATGG - Intergenic
979500764 4:121437148-121437170 GGGTTCAGGATGCATTTGAAAGG - Intergenic
982138681 4:152296678-152296700 TACCTTAACATGCATTTCAAAGG - Intergenic
982701007 4:158659738-158659760 TGGCTTAGGATGCATTTCAAGGG - Intergenic
982877183 4:160664109-160664131 TGGCTTAGGATGCATTTCAAGGG - Intergenic
982969151 4:161958901-161958923 AGGCTAAGGCTGCAGTTCAAAGG - Intronic
982996138 4:162348786-162348808 TGGCTGAGGAAGAATTTGAAAGG + Intergenic
983321616 4:166202554-166202576 GGGTTAAGGATGCATTTGAAAGG - Intergenic
983561569 4:169106954-169106976 TGGCCCAGGATGCTTTTCATAGG - Exonic
983835045 4:172375412-172375434 TAGCTTTGGATGCATTTCAAGGG + Intronic
984327799 4:178275375-178275397 GGGTTCAGGATGCATTTGAAAGG - Intergenic
984917329 4:184736205-184736227 CGGCTTAGGATGCATTTCAAGGG - Intergenic
985364858 4:189217863-189217885 TAGCGTTGGATGCTTTTCAATGG - Intergenic
986986542 5:13506781-13506803 TGATTTAGGATGTATTTTAAAGG + Intergenic
987545357 5:19305546-19305568 TGGCTTAGGATGCATTTCAAAGG + Intergenic
987929775 5:24388941-24388963 TGGCTTAGGATGCATTTCAAGGG - Intergenic
988592137 5:32558103-32558125 TGGCTTAGGATGCATTTCAAGGG + Intronic
988605614 5:32676223-32676245 TGGCTTAGGATGCATTTCAAGGG + Intergenic
988899646 5:35718386-35718408 GGGGTCAGGATGCATTTGAAAGG + Intronic
989496123 5:42113074-42113096 TGGCTTAGGATGCATTTCAAGGG - Intergenic
989780034 5:45253894-45253916 TGGTTTAGGAGGAATGTCAATGG + Intergenic
989957229 5:50372099-50372121 TGGCTTAGGATGCATTTCAAGGG - Intergenic
989964484 5:50451823-50451845 TGGCTTAGGATGCATTGCAAGGG + Intergenic
990116616 5:52399063-52399085 TGGCTTAGGATGCATTTCAAGGG - Intergenic
990367991 5:55089417-55089439 TGGCTTAGGATGCACTTCAAGGG + Intergenic
990791087 5:59480885-59480907 TGACTTAAAATCCATTTCAAGGG - Intronic
991014337 5:61915299-61915321 GGGTTCAGGATGCATTTGAAAGG - Intergenic
992049245 5:72928072-72928094 TGGCTTAGGATGCATTTCAAGGG - Intergenic
992545648 5:77811773-77811795 TGGCTTAGGATGCATTTCGAGGG - Intronic
993432785 5:87852327-87852349 TGGCTAAGGATGAGTTTCAGAGG - Intergenic
994231860 5:97316504-97316526 TGACTTAGGATGCATTTCAAGGG + Intergenic
995583544 5:113624041-113624063 TGGCTTAGGATGCATTTCACGGG + Intergenic
995706264 5:114991836-114991858 TGGCTTAGGATGCATTTCACAGG - Intergenic
995844780 5:116481837-116481859 TGGCTTAGAATTCTTTTCATGGG - Intronic
996099356 5:119431090-119431112 TAGCTTAGGATGCATTTCAAGGG + Intergenic
996680254 5:126223061-126223083 TGGCTTAGGACGCATTTCAAGGG - Intergenic
996917519 5:128730047-128730069 TGTCTTATGCTGCTTTTCAAAGG - Intronic
997072280 5:130635359-130635381 TGGCTTAGGATGCATTTCAAGGG - Intergenic
998111342 5:139505099-139505121 TGACTGAGGATGCATTTCAAGGG - Intergenic
998914939 5:147002908-147002930 TGGCTTAGGATGCATTTCAAGGG - Intronic
998939179 5:147261929-147261951 TGCCTTAGGATACATTTATAGGG + Intronic
1000085106 5:157881783-157881805 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1001531038 5:172461993-172462015 TGGCTTATGTTTCATGTCAATGG + Intergenic
1003389048 6:5697403-5697425 TGGCTTAAGATTCCCTTCAATGG - Intronic
1004531241 6:16457454-16457476 TGGCTTAGGATGCGTTTCAAGGG - Intronic
1004812116 6:19272989-19273011 TGATTTAGGATGCATTTCAAGGG - Intergenic
1005664968 6:28043339-28043361 TGGCTTAGGAAGCAATTGAATGG - Intergenic
1005888720 6:30118616-30118638 TGACTTAAAATGCATTTGAACGG + Intergenic
1007029899 6:38618170-38618192 TGGCTTAGGATGCATTTCAAGGG - Intronic
1008587127 6:52960285-52960307 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1009386061 6:63085030-63085052 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1009470678 6:64026388-64026410 TGGCTTAGGATGCATTTCAAGGG - Intronic
1009872650 6:69469903-69469925 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1010074821 6:71787327-71787349 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1010269706 6:73905645-73905667 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1010453641 6:76030427-76030449 GGGTTCAGGATGCATTTGAAAGG - Intronic
1010486644 6:76422378-76422400 TGGCCCAGGATGCTTTTAAATGG - Intergenic
1010620984 6:78074198-78074220 TGGCTGAGCATTCATTTGAAAGG + Intergenic
1010846391 6:80713892-80713914 AGGCTTAGGAGGCCATTCAATGG + Intergenic
1011375170 6:86679623-86679645 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1013498655 6:110724313-110724335 TTGCTTAGGCTGCAGTGCAATGG - Intronic
1013907978 6:115239389-115239411 TGGCTTAGGATACATTTCAAGGG + Intergenic
1015813520 6:137185125-137185147 GGGTTCAGGATGCATTTGAAAGG + Intergenic
1016162036 6:140894298-140894320 CGGTTCAGGATGCATTTGAAAGG + Intergenic
1016183899 6:141177926-141177948 TGTCTTAGGATACATTTCAAGGG - Intergenic
1016821603 6:148351700-148351722 GTGCTTAGGATACATTTTAAAGG - Intronic
1018876206 6:167825670-167825692 AGGCTTTGTGTGCATTTCAAGGG - Intergenic
1021356703 7:19659264-19659286 TGGCTTAGGATGCACTTCAAGGG + Intergenic
1021648215 7:22807538-22807560 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1021756852 7:23860314-23860336 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1022195876 7:28066898-28066920 TGTCTTTGGATGCATTTGTAGGG - Intronic
1022322213 7:29297886-29297908 GGGTTCAGGATGCATTTGAAAGG + Intronic
1023078082 7:36502997-36503019 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1023151175 7:37202843-37202865 TGGCTTAGGATGTATTTCAAGGG + Intronic
1024398316 7:48894278-48894300 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1024438014 7:49381721-49381743 AGGTTCAGGATGCATTTGAAAGG - Intergenic
1024735154 7:52296580-52296602 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1024870915 7:53961002-53961024 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1024907572 7:54405307-54405329 TGTCTTGGGCTGCTTTTCAAGGG + Intergenic
1025269246 7:57493707-57493729 TGGAATAGAATGCATTGCAATGG + Intergenic
1027383990 7:77642077-77642099 TTGCCTAGGATGGATTGCAATGG - Intergenic
1027790994 7:82638853-82638875 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1028495352 7:91454562-91454584 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1028898189 7:96065415-96065437 TGGCTTAGGCTGGAGTTCAGTGG + Intronic
1030420388 7:109300959-109300981 TGGCTTACCATGCATTTCAAGGG - Intergenic
1031731643 7:125309587-125309609 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1032921907 7:136558534-136558556 TGGCTGACCATGAATTTCAAAGG + Intergenic
1033759385 7:144423157-144423179 TAGCTTAGGATGCATTTCAAGGG + Intergenic
1034407517 7:150915073-150915095 TGGCCTCCCATGCATTTCAATGG + Intergenic
1034580112 7:152034517-152034539 TGGCTTAGGATGCATTTCAAGGG + Intronic
1035221447 7:157408765-157408787 GGGTTTCAGATGCATTTCAATGG + Intronic
1037487613 8:19363422-19363444 TGCCTTATGATGCATTTCTCAGG + Intronic
1038181086 8:25228375-25228397 TCACTTAGGATGGAGTTCAAGGG + Intronic
1038638654 8:29306742-29306764 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1039693311 8:39883728-39883750 TGACTGAGGATGCATTTCAAGGG + Intergenic
1039824944 8:41165134-41165156 TGGCTTCGGGTGCATTGCACAGG - Intergenic
1039999813 8:42566387-42566409 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1040064980 8:43138413-43138435 TGGCTTAGGATTGGTTTCAGGGG + Intergenic
1040527078 8:48234808-48234830 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1040668004 8:49655241-49655263 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1040796933 8:51297513-51297535 TGGCTTAGGATGCATTTCATGGG + Intergenic
1040965191 8:53075333-53075355 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1042101034 8:65275262-65275284 GGGCTTATTCTGCATTTCAATGG - Intergenic
1042335218 8:67622846-67622868 TGGTTTAGGCTTCATTTTAATGG - Intronic
1042919477 8:73907777-73907799 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1043256927 8:78149378-78149400 TTGCTTAGGATGCATTTCAAGGG - Intergenic
1043923525 8:86010953-86010975 TGGCTTATGCTGGTTTTCAAAGG + Intronic
1045858412 8:106790322-106790344 TTGTTTAGGATGCATTTCATGGG - Intergenic
1048176072 8:132153953-132153975 GGGTTCAGGATGCATTTGAAAGG - Intronic
1050092908 9:2033532-2033554 TGGATAAGCATGCAATTCAAGGG - Intronic
1050909015 9:11042612-11042634 TGGCTTTGGATCCATTTCAAGGG - Intergenic
1050987181 9:12097665-12097687 TGACATAGGAGGCAGTTCAAAGG + Intergenic
1051769383 9:20559640-20559662 TGCCATGTGATGCATTTCAAAGG - Intronic
1051912734 9:22173096-22173118 TGGCTAAGGATATATTTCAGAGG - Intergenic
1051935133 9:22436305-22436327 AGGCTTAGGATGCATTTCAAGGG - Intergenic
1052059358 9:23941954-23941976 TGGTTCAGGATGCATTCAAAAGG + Intergenic
1053067543 9:35079179-35079201 TGGCTCAGGATGCACTGGAAGGG - Exonic
1053330457 9:37201664-37201686 TGCCCTAGGATGCATGTCATTGG - Intronic
1053623002 9:39839978-39840000 TGGCTTAGGAGACTTTTTAAGGG - Intergenic
1053754276 9:41288120-41288142 AGTCTTAGGATGTAATTCAAAGG + Intergenic
1053881871 9:42603249-42603271 TGGCTTAGGAGACTTTTTAAGGG + Intergenic
1053890801 9:42691040-42691062 TGGCTTAGGAGACTTTTTAAGGG - Intergenic
1054220895 9:62410714-62410736 TGGCTTAGGAGACTTTTTAAGGG + Intergenic
1054229819 9:62498458-62498480 TGGCTTAGGAGACTTTTTAAGGG - Intergenic
1054259793 9:62852473-62852495 AGTCTTAGGATGTAATTCAAAGG + Intergenic
1054331975 9:63767552-63767574 AGTCTTAGGATGTAATTCAAAGG - Intergenic
1054890343 9:70244369-70244391 TGGCTTGTGCTGGATTTCAAAGG - Intergenic
1055458416 9:76493981-76494003 TGGCTTAGGATGCATTTCAAGGG + Intronic
1056392926 9:86155512-86155534 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1056834936 9:89946726-89946748 TGGCTTATGAGGGTTTTCAAGGG + Intergenic
1060377493 9:123130017-123130039 TGGCTAAGGCTGCAGTTCTAAGG + Intronic
1188136385 X:26499231-26499253 TGGCTTAGGATGTATCTCAAGGG - Intergenic
1189153380 X:38730206-38730228 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1190065966 X:47242005-47242027 TGGCTTGGGGTGCATTCAAATGG - Intronic
1190541316 X:51481389-51481411 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1191206075 X:57835241-57835263 TGGCTTAGGAAGCATTTCAAGGG + Intergenic
1192482905 X:71500431-71500453 TGGCTTAGGATGCATTTCAAGGG + Intronic
1192870156 X:75176990-75177012 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1194027494 X:88770783-88770805 GGGTTTAGGATGCATTCTAAAGG - Intergenic
1194066369 X:89267014-89267036 GGGCTCAGGATGCATTTGAAAGG + Intergenic
1195439429 X:104884515-104884537 TGGCTTAGGATGCATTTCAAAGG - Intronic
1196127491 X:112115033-112115055 TGGCATAGGATGCATTTCAAGGG + Intergenic
1196309783 X:114150334-114150356 TGCCTAAGGATGCATTTCCCAGG - Intergenic
1196419527 X:115507864-115507886 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1196488848 X:116245262-116245284 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1196563427 X:117177586-117177608 GGGTTCAGGATGCATTTGAAAGG - Intergenic
1196662089 X:118280157-118280179 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1197480617 X:126980688-126980710 TGGCTTTGGATGAAATACAAAGG + Intergenic
1197513271 X:127396784-127396806 TGGCTTAAGATGCATTTCAAGGG - Intergenic
1198805643 X:140491499-140491521 TGGGGTAGGATCCATTTCCAAGG - Intergenic
1199832554 X:151560453-151560475 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1200695098 Y:6351675-6351697 TGGCTTAGGATGCACTGCAATGG + Intergenic
1200711137 Y:6486043-6486065 TGGCTTAGGATGCATTTCAATGG - Intergenic
1200720539 Y:6601132-6601154 GGGCTCAGGATGCATTTGAAAGG + Intergenic
1200801154 Y:7388115-7388137 TGGCTTAGGATGCATTTCAAAGG + Intergenic
1200959198 Y:8981748-8981770 TGGCTAAGGATATATTTCAAGGG - Intergenic
1200966641 Y:9045082-9045104 TGGCTTAAGATGAATTCCAAGGG - Intergenic
1201022798 Y:9675943-9675965 TGGCTTAGGATGCATTTCAATGG + Intergenic
1201040179 Y:9823035-9823057 TGGCTTAGGATGCACTGCAATGG - Intergenic
1201108167 Y:10779040-10779062 TGGATTGGGATGGATTGCAATGG - Intergenic
1201113344 Y:10816661-10816683 TGGCTCAGAATGCATTGGAATGG - Intergenic
1201196122 Y:11496280-11496302 TGGAATAGAATGCAATTCAATGG + Intergenic
1201272054 Y:12264938-12264960 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1201312186 Y:12606941-12606963 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1201403645 Y:13629571-13629593 TGGCTTAGGATGCATTTCAACGG - Intergenic
1201407636 Y:13664586-13664608 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1201429559 Y:13890712-13890734 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1201454991 Y:14160008-14160030 TGGCTTACAATGAATTTCAAGGG - Intergenic
1201468700 Y:14311998-14312020 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1201496545 Y:14595638-14595660 TGGCTTAGGATGCATTTCAAGGG + Intronic
1201516100 Y:14819944-14819966 TGGCTTAGGATGCATTTCAAGGG + Intronic
1201555599 Y:15262486-15262508 TGGCTTAGAATGCATTTCAAGGG - Intergenic
1201604588 Y:15771216-15771238 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1201631128 Y:16073017-16073039 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1201649027 Y:16265140-16265162 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1201653782 Y:16320160-16320182 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1201729720 Y:17190884-17190906 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1201744119 Y:17352181-17352203 TGGCTTAGGATGCCTTTCAAGGG + Intergenic
1201908337 Y:19107495-19107517 AGGCTTAGGATACATTTCAAGGG + Intergenic
1201910981 Y:19133285-19133307 TGGCTTATAACGCATTTCAAGGG - Intergenic
1201989650 Y:20009724-20009746 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1202090003 Y:21179292-21179314 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1202146818 Y:21807094-21807116 TGGCTTAGGATGCATTCCAAGGG + Intergenic
1202192749 Y:22261093-22261115 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1202242746 Y:22787916-22787938 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1202272203 Y:23083168-23083190 TGGTTTAGCATGCATTTCAAGGG + Intergenic
1202293823 Y:23337514-23337536 TGGTTTAGCATGCATTTCAAGGG - Intergenic
1202350823 Y:23989034-23989056 TGGCTTAGGAATCAGTGCAATGG + Intergenic
1202395733 Y:24421666-24421688 TGGCTTAGGATGCATTTCAAGGG - Intergenic
1202425200 Y:24716912-24716934 TGGTTTAGCATGCATTTCAAGGG + Intergenic
1202445589 Y:24953173-24953195 TGGTTTAGCATGCATTTCAAGGG - Intergenic
1202475052 Y:25248426-25248448 TGGCTTAGGATGCATTTCAAGGG + Intergenic
1202519956 Y:25681085-25681107 TGGCTTAGGAATCAGTGCAATGG - Intergenic