ID: 1099576954

View in Genome Browser
Species Human (GRCh38)
Location 12:84393859-84393881
Sequence CATTTCAAGGGTGATCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099576950_1099576954 -6 Left 1099576950 12:84393842-84393864 CCCAATGGCTTAGGATGCATTTC 0: 129
1: 86
2: 31
3: 22
4: 164
Right 1099576954 12:84393859-84393881 CATTTCAAGGGTGATCCTGTTGG No data
1099576944_1099576954 29 Left 1099576944 12:84393807-84393829 CCACCTCTTTTTCAGGGTTTTCA No data
Right 1099576954 12:84393859-84393881 CATTTCAAGGGTGATCCTGTTGG No data
1099576946_1099576954 26 Left 1099576946 12:84393810-84393832 CCTCTTTTTCAGGGTTTTCAGGT No data
Right 1099576954 12:84393859-84393881 CATTTCAAGGGTGATCCTGTTGG No data
1099576951_1099576954 -7 Left 1099576951 12:84393843-84393865 CCAATGGCTTAGGATGCATTTCA 0: 134
1: 88
2: 33
3: 18
4: 174
Right 1099576954 12:84393859-84393881 CATTTCAAGGGTGATCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099576954 Original CRISPR CATTTCAAGGGTGATCCTGT TGG Intergenic
No off target data available for this crispr