ID: 1099578071

View in Genome Browser
Species Human (GRCh38)
Location 12:84405367-84405389
Sequence AGGCATATACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099578071_1099578077 12 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG No data
1099578071_1099578078 13 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578078 12:84405403-84405425 GCAGCTTTTGGCCTGTTACTGGG No data
1099578071_1099578075 1 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578075 12:84405391-84405413 TCCTTTTGAGAGGCAGCTTTTGG No data
1099578071_1099578079 22 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578079 12:84405412-84405434 GGCCTGTTACTGGGCTTTTGTGG No data
1099578071_1099578073 -9 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578073 12:84405381-84405403 TATATGCCTCTCCTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099578071 Original CRISPR AGGCATATACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr