ID: 1099578077

View in Genome Browser
Species Human (GRCh38)
Location 12:84405402-84405424
Sequence GGCAGCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099578072_1099578077 8 Left 1099578072 12:84405371-84405393 CCATCTTCTGTATATGCCTCTCC No data
Right 1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG No data
1099578071_1099578077 12 Left 1099578071 12:84405367-84405389 CCTGCCATCTTCTGTATATGCCT No data
Right 1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG No data
1099578074_1099578077 -8 Left 1099578074 12:84405387-84405409 CCTCTCCTTTTGAGAGGCAGCTT No data
Right 1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG No data
1099578070_1099578077 13 Left 1099578070 12:84405366-84405388 CCCTGCCATCTTCTGTATATGCC No data
Right 1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099578077 Original CRISPR GGCAGCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr