ID: 1099580170

View in Genome Browser
Species Human (GRCh38)
Location 12:84435996-84436018
Sequence TAGCCAAGGCTCCCACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099580170_1099580172 4 Left 1099580170 12:84435996-84436018 CCTCTCAGTGGGAGCCTTGGCTA No data
Right 1099580172 12:84436023-84436045 AGCTATTCCATCCGAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099580170 Original CRISPR TAGCCAAGGCTCCCACTGAG AGG (reversed) Intergenic
No off target data available for this crispr