ID: 1099584370

View in Genome Browser
Species Human (GRCh38)
Location 12:84497997-84498019
Sequence TGCCCACTAGAGCCCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099584366_1099584370 28 Left 1099584366 12:84497946-84497968 CCTGCCAGAAACAGCAAGGAAAT No data
Right 1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG No data
1099584368_1099584370 24 Left 1099584368 12:84497950-84497972 CCAGAAACAGCAAGGAAATGGAC No data
Right 1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG No data
1099584369_1099584370 -10 Left 1099584369 12:84497984-84498006 CCTGTCTTCTAATTGCCCACTAG No data
Right 1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099584370 Original CRISPR TGCCCACTAGAGCCCCCTGT TGG Intergenic
No off target data available for this crispr