ID: 1099594235

View in Genome Browser
Species Human (GRCh38)
Location 12:84637961-84637983
Sequence TTATTGGCTTTGAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099594231_1099594235 22 Left 1099594231 12:84637916-84637938 CCTAAGATCAACATCAGGAGAGA No data
Right 1099594235 12:84637961-84637983 TTATTGGCTTTGAAGCTGGTGGG No data
1099594229_1099594235 30 Left 1099594229 12:84637908-84637930 CCTAATCACCTAAGATCAACATC No data
Right 1099594235 12:84637961-84637983 TTATTGGCTTTGAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099594235 Original CRISPR TTATTGGCTTTGAAGCTGGT GGG Intergenic
No off target data available for this crispr