ID: 1099595025

View in Genome Browser
Species Human (GRCh38)
Location 12:84650756-84650778
Sequence GCTTATGTTGGTTTGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099595020_1099595025 -10 Left 1099595020 12:84650743-84650765 CCCTGCTCCCTCTGCTTATGTTG No data
Right 1099595025 12:84650756-84650778 GCTTATGTTGGTTTGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099595025 Original CRISPR GCTTATGTTGGTTTGAATAT TGG Intergenic
No off target data available for this crispr