ID: 1099604174

View in Genome Browser
Species Human (GRCh38)
Location 12:84780730-84780752
Sequence TTGCTGTCTCAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099604170_1099604174 21 Left 1099604170 12:84780686-84780708 CCTGTTGAAACAGAGGGAATATG No data
Right 1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099604174 Original CRISPR TTGCTGTCTCAGATGGAACA TGG Intergenic
No off target data available for this crispr