ID: 1099605544

View in Genome Browser
Species Human (GRCh38)
Location 12:84797572-84797594
Sequence TCTAGGGATGGGGAATTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099605544_1099605551 -8 Left 1099605544 12:84797572-84797594 CCCTTTAATTCCCCATCCCTAGA No data
Right 1099605551 12:84797587-84797609 TCCCTAGATATATCCTGGGAAGG No data
1099605544_1099605559 27 Left 1099605544 12:84797572-84797594 CCCTTTAATTCCCCATCCCTAGA No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099605544 Original CRISPR TCTAGGGATGGGGAATTAAA GGG (reversed) Intergenic