ID: 1099605552

View in Genome Browser
Species Human (GRCh38)
Location 12:84797588-84797610
Sequence TCCTTCCCAGGATATATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099605552_1099605564 24 Left 1099605552 12:84797588-84797610 CCCTAGATATATCCTGGGAAGGA No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605552_1099605560 20 Left 1099605552 12:84797588-84797610 CCCTAGATATATCCTGGGAAGGA No data
Right 1099605560 12:84797631-84797653 TACCCCAACCACGGTTAAAGTGG No data
1099605552_1099605559 11 Left 1099605552 12:84797588-84797610 CCCTAGATATATCCTGGGAAGGA No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099605552 Original CRISPR TCCTTCCCAGGATATATCTA GGG (reversed) Intergenic