ID: 1099605554

View in Genome Browser
Species Human (GRCh38)
Location 12:84797600-84797622
Sequence GACTGGGTAGGGTCCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099605554_1099605566 25 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605566 12:84797648-84797670 AAGTGGCTGGAGTGAAGTCTTGG No data
1099605554_1099605559 -1 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605554_1099605560 8 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605560 12:84797631-84797653 TACCCCAACCACGGTTAAAGTGG No data
1099605554_1099605564 12 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099605554 Original CRISPR GACTGGGTAGGGTCCTTCCC AGG (reversed) Intergenic