ID: 1099605559

View in Genome Browser
Species Human (GRCh38)
Location 12:84797622-84797644
Sequence CATTTTATCTACCCCAACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099605552_1099605559 11 Left 1099605552 12:84797588-84797610 CCCTAGATATATCCTGGGAAGGA No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605544_1099605559 27 Left 1099605544 12:84797572-84797594 CCCTTTAATTCCCCATCCCTAGA No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605554_1099605559 -1 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605553_1099605559 10 Left 1099605553 12:84797589-84797611 CCTAGATATATCCTGGGAAGGAC No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605545_1099605559 26 Left 1099605545 12:84797573-84797595 CCTTTAATTCCCCATCCCTAGAT No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605548_1099605559 16 Left 1099605548 12:84797583-84797605 CCCATCCCTAGATATATCCTGGG No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605550_1099605559 15 Left 1099605550 12:84797584-84797606 CCATCCCTAGATATATCCTGGGA No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data
1099605546_1099605559 17 Left 1099605546 12:84797582-84797604 CCCCATCCCTAGATATATCCTGG No data
Right 1099605559 12:84797622-84797644 CATTTTATCTACCCCAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099605559 Original CRISPR CATTTTATCTACCCCAACCA CGG Intergenic
No off target data available for this crispr