ID: 1099605564

View in Genome Browser
Species Human (GRCh38)
Location 12:84797635-84797657
Sequence CCAACCACGGTTAAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099605556_1099605564 0 Left 1099605556 12:84797612-84797634 CCTACCCAGTCATTTTATCTACC 0: 11
1: 4
2: 3
3: 7
4: 157
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605548_1099605564 29 Left 1099605548 12:84797583-84797605 CCCATCCCTAGATATATCCTGGG No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605558_1099605564 -5 Left 1099605558 12:84797617-84797639 CCAGTCATTTTATCTACCCCAAC No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605555_1099605564 1 Left 1099605555 12:84797611-84797633 CCCTACCCAGTCATTTTATCTAC 0: 10
1: 4
2: 1
3: 11
4: 238
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605546_1099605564 30 Left 1099605546 12:84797582-84797604 CCCCATCCCTAGATATATCCTGG No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605554_1099605564 12 Left 1099605554 12:84797600-84797622 CCTGGGAAGGACCCTACCCAGTC No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605550_1099605564 28 Left 1099605550 12:84797584-84797606 CCATCCCTAGATATATCCTGGGA No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605553_1099605564 23 Left 1099605553 12:84797589-84797611 CCTAGATATATCCTGGGAAGGAC No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605552_1099605564 24 Left 1099605552 12:84797588-84797610 CCCTAGATATATCCTGGGAAGGA No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data
1099605557_1099605564 -4 Left 1099605557 12:84797616-84797638 CCCAGTCATTTTATCTACCCCAA No data
Right 1099605564 12:84797635-84797657 CCAACCACGGTTAAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099605564 Original CRISPR CCAACCACGGTTAAAGTGGC TGG Intergenic
No off target data available for this crispr