ID: 1099606283

View in Genome Browser
Species Human (GRCh38)
Location 12:84805764-84805786
Sequence AAGAGTAAGCACTCTGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099606283_1099606285 -3 Left 1099606283 12:84805764-84805786 CCCTCATCAGAGTGCTTACTCTT No data
Right 1099606285 12:84805784-84805806 CTTCTCTCCTTTCATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099606283 Original CRISPR AAGAGTAAGCACTCTGATGA GGG (reversed) Intergenic
No off target data available for this crispr