ID: 1099607848

View in Genome Browser
Species Human (GRCh38)
Location 12:84828251-84828273
Sequence CAAAATGCTAATACTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099607845_1099607848 4 Left 1099607845 12:84828224-84828246 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099607848 Original CRISPR CAAAATGCTAATACTGATAT GGG Intergenic
No off target data available for this crispr