ID: 1099608566

View in Genome Browser
Species Human (GRCh38)
Location 12:84836190-84836212
Sequence AGCATGGATCTGAGCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099608566_1099608569 12 Left 1099608566 12:84836190-84836212 CCTCAGGAGCTCAGATCCATGCT No data
Right 1099608569 12:84836225-84836247 AACTCAGATCTCTAAAGAGAGGG No data
1099608566_1099608568 11 Left 1099608566 12:84836190-84836212 CCTCAGGAGCTCAGATCCATGCT No data
Right 1099608568 12:84836224-84836246 CAACTCAGATCTCTAAAGAGAGG No data
1099608566_1099608570 26 Left 1099608566 12:84836190-84836212 CCTCAGGAGCTCAGATCCATGCT No data
Right 1099608570 12:84836239-84836261 AAGAGAGGGCTCTACCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099608566 Original CRISPR AGCATGGATCTGAGCTCCTG AGG (reversed) Intergenic