ID: 1099618546

View in Genome Browser
Species Human (GRCh38)
Location 12:84972158-84972180
Sequence AGTCACTTGCTCCCGAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099618543_1099618546 26 Left 1099618543 12:84972109-84972131 CCTTGCTTGATAGCAACATGTGT No data
Right 1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099618546 Original CRISPR AGTCACTTGCTCCCGAGGAA AGG Intergenic
No off target data available for this crispr