ID: 1099622628

View in Genome Browser
Species Human (GRCh38)
Location 12:85024303-85024325
Sequence GACTGAAGACAGTCTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099622624_1099622628 19 Left 1099622624 12:85024261-85024283 CCTAAGGAATATCTAGCCATAAA 0: 1
1: 0
2: 0
3: 24
4: 188
Right 1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 105
1099622626_1099622628 3 Left 1099622626 12:85024277-85024299 CCATAAACCTTATAAAAGCAGGA 0: 1
1: 0
2: 1
3: 20
4: 238
Right 1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 105
1099622627_1099622628 -4 Left 1099622627 12:85024284-85024306 CCTTATAAAAGCAGGAGATGACT 0: 1
1: 1
2: 1
3: 21
4: 243
Right 1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099622628 Original CRISPR GACTGAAGACAGTCTCTAGC TGG Intronic
901940660 1:12659176-12659198 GACGAAGGACAGTCTCTAGCTGG + Intronic
906849236 1:49230040-49230062 GTGTGAAGACAGGCTCTACCTGG - Intronic
907192091 1:52657888-52657910 GACTGAATACAGGCTCCAGAGGG + Intronic
907807647 1:57837559-57837581 GGCAGAAGAGAGTCTCAAGCAGG - Intronic
908518924 1:64921908-64921930 GACTGAAGTCATGCTATAGCTGG - Intronic
909163845 1:72191594-72191616 GAATTAAAACAGTCTCTATCAGG - Intronic
909701223 1:78525620-78525642 GATTGAACTCAGTCTCTAGAAGG + Intronic
910799892 1:91134646-91134668 GAATGAAGATAGTATCTAGATGG + Intergenic
915959360 1:160252037-160252059 AACTGCAGAGAGACTCTAGCAGG + Intronic
918708424 1:187696932-187696954 GAATGAAGACTCTATCTAGCTGG + Intergenic
918805944 1:189044820-189044842 GAATGAAGACAATCTCAATCTGG - Intergenic
919176916 1:194030766-194030788 AGCTAAAGACATTCTCTAGCTGG - Intergenic
921056981 1:211549733-211549755 GACAGAAGCCAGTCTCTCTCTGG + Intergenic
1066422434 10:35275459-35275481 GACTGGACACACTCTTTAGCTGG - Intronic
1068105698 10:52613295-52613317 GCCTGAAATCATTCTCTAGCTGG - Intergenic
1068724256 10:60283311-60283333 TACTCAACACAGTCTATAGCTGG + Intronic
1072457055 10:95585724-95585746 GACTGAAGTCACTCTAGAGCAGG + Intergenic
1074027212 10:109649139-109649161 GGCTGCTGACAGTCTCTTGCTGG - Intergenic
1076509513 10:131002389-131002411 GACACAAGACAGACTCTGGCAGG + Intergenic
1078577157 11:12512272-12512294 AAGAGAAGACAGTCTCTAGAAGG - Intronic
1079519734 11:21312510-21312532 TACTGAAGCCAGTGTCTGGCAGG - Intronic
1080038779 11:27737021-27737043 GTCAGAAGCAAGTCTCTAGCAGG - Intergenic
1086781743 11:90915447-90915469 GAGTGAAGACAGTATGGAGCAGG + Intergenic
1092668877 12:10839775-10839797 GAGTGAAGACAGTCACTGGGTGG - Intronic
1098907890 12:76180384-76180406 GACTTAAGCTAGTCTCTAGCTGG + Intergenic
1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG + Intronic
1108502614 13:51081890-51081912 AGCAGAAGACAGTCTGTAGCGGG + Intergenic
1109653355 13:65357305-65357327 GAGTGAAGTAAGTCTCTTGCAGG - Intergenic
1112283923 13:98087408-98087430 GACTGAAGCTACACTCTAGCTGG + Intergenic
1117346614 14:54839227-54839249 GACAGATGACAGTCTCTTGTGGG - Intergenic
1124119733 15:26878582-26878604 AACTGAAGATAGCCTCTAGGAGG - Intronic
1124161416 15:27273484-27273506 TACTGAAGACAGACTCGACCTGG - Intronic
1124423039 15:29539026-29539048 GACTGAAGTCAGTCCCCAGCAGG - Intronic
1125871298 15:43104598-43104620 GACTGAAGAGACTGTCTAGGAGG - Intronic
1125891215 15:43268600-43268622 GACAGAAGGCAGTCTGCAGCAGG - Intergenic
1129881632 15:79010544-79010566 CACTGAATACACTTTCTAGCAGG - Intronic
1130405481 15:83597171-83597193 GACTGCAGGCAGCCTCTAGAAGG - Intronic
1130436798 15:83908350-83908372 CACTGAAGACAGTGTCTCACAGG + Intronic
1133476175 16:6124254-6124276 GACTGAAGACTCTCTTTAGAGGG - Intronic
1137497852 16:48984535-48984557 TTCTGGAGACAGTCTCTAGGAGG - Intergenic
1141546415 16:84772775-84772797 GAGTGAGGACATTCTCTTGCTGG + Intronic
1143337697 17:6185634-6185656 GGTTGAAAACAGTCTCTTGCTGG + Intergenic
1148779854 17:50115273-50115295 GAATGAAGGAAGTCTCCAGCTGG + Intronic
1148987298 17:51634149-51634171 AAAAGAAGACGGTCTCTAGCAGG + Intronic
1150260237 17:63783703-63783725 GAGTAAAGACAGTTTCTATCTGG + Intronic
1154316870 18:13311252-13311274 GACTGAAGTCAGTCCCTGTCTGG - Intronic
1155917786 18:31573013-31573035 GAGTGAAAACAGTCTCTAGGTGG + Intergenic
1158412243 18:57217683-57217705 GAATGAAGACAGTGTGTAACTGG - Intergenic
1162221309 19:9179047-9179069 TGCTGAAGACAGAATCTAGCAGG - Intergenic
1163494612 19:17639024-17639046 GACTGAAGCCTGTGTCTAGTTGG + Intronic
1168214695 19:54916937-54916959 GAGAGAAGCCAGTTTCTAGCGGG - Intergenic
926332978 2:11840360-11840382 GACTGAAGCCAGTGTCTGGAGGG + Intergenic
928345563 2:30491168-30491190 GACAGAAGACAGTATGTATCTGG + Intronic
931297677 2:60945017-60945039 GACTGCAGACATTCTGGAGCTGG - Exonic
933324860 2:80822697-80822719 GACTAAAGACAGTGTTTAACAGG + Intergenic
937296825 2:120814532-120814554 GACTGGTGCCAGTCTGTAGCCGG - Intronic
938127945 2:128687813-128687835 GACTGAAGGGACCCTCTAGCAGG + Intergenic
940523440 2:154781117-154781139 GACTAAAGGCAGTCTTTAGAAGG + Intronic
945081974 2:206094964-206094986 GACTGAAGACACTCGCAGGCAGG - Intergenic
1170010398 20:11716328-11716350 GACTGAAGCTAGACTCCAGCTGG + Intergenic
1178700331 21:34827908-34827930 CACTGCAGACAGTACCTAGCAGG + Intronic
1181181146 22:21069508-21069530 GAGGGAAGACAGTCTTTACCTGG + Intergenic
1184972475 22:48036114-48036136 GAGGGAAAACATTCTCTAGCAGG - Intergenic
950089001 3:10281626-10281648 TACTCAAGAAAGTCTCCAGCTGG - Intronic
951613598 3:24519533-24519555 GACTAAAGCCAGTCTCCAGTAGG + Intergenic
954652007 3:52170823-52170845 GAGTGAAGACAGCCTCTTGTAGG - Intergenic
957817672 3:85323179-85323201 GACTGAATGCAATCTCTACCTGG + Intronic
958450767 3:94269642-94269664 GACTGAATACCATCACTAGCAGG + Intergenic
961376906 3:126473309-126473331 GAATGATGAGGGTCTCTAGCAGG - Intronic
961475395 3:127142792-127142814 TACTGAAAACAGTGTCTGGCAGG - Intergenic
962603488 3:137012551-137012573 CACTGAAGACTGTCTCTTGCAGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
966837431 3:184059868-184059890 TAATGAAGACGGTCTCCAGCAGG - Exonic
970317327 4:14841911-14841933 GGCTGCAGATAGTCTCTAGTAGG - Intergenic
978430565 4:108628604-108628626 GACTGGACACAGGCTCTAGCTGG + Intronic
978618801 4:110620119-110620141 GAATGAAGACACTCTCTGGGTGG - Intronic
979009943 4:115355099-115355121 AACAGAACTCAGTCTCTAGCAGG - Intergenic
983063827 4:163188040-163188062 GGGTGAAGAGAGTCTCAAGCAGG - Intergenic
986190707 5:5494180-5494202 AACTGAATCCAGTCCCTAGCTGG + Intergenic
987211354 5:15686926-15686948 AAGTGAAGACAATCTCTATCTGG + Intronic
989118250 5:37977651-37977673 GACTCAAATCAGTCTCTATCAGG + Intergenic
992561827 5:77959924-77959946 GACTGGGGACAGGCTCTAGAGGG - Intergenic
994426533 5:99595348-99595370 AACTGTAGACAGTCCCTGGCAGG + Intergenic
1003373512 6:5551764-5551786 AACTGAGGACTGTCTCTAGACGG - Intronic
1008105087 6:47432340-47432362 GACTGATGATAGTCTAAAGCAGG + Intergenic
1008286373 6:49657031-49657053 AACTGGAGACTATCTCTAGCAGG + Intergenic
1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG + Intergenic
1014490706 6:122058299-122058321 GAATAAAGAAAGTCTCTAGGAGG + Intergenic
1016420513 6:143877648-143877670 ATCTGAAGAACGTCTCTAGCAGG - Intronic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1021498486 7:21303183-21303205 TACTGGAGACAGTCTCTGGGGGG + Intergenic
1022572222 7:31466320-31466342 GCCTGAAGACAGTTTCCAACTGG - Intergenic
1028688216 7:93617902-93617924 AATTGAAGACATTCTCTATCTGG + Intronic
1031137476 7:117900817-117900839 GAATGCAGACAGTCTCTAAAAGG - Intergenic
1032154445 7:129456513-129456535 GGCTGAAGACAGTATCCAGGTGG + Exonic
1033036695 7:137882248-137882270 GACTGCAGAGAGTCTGTTGCTGG - Intronic
1034591656 7:152145340-152145362 GACTACAGACAATCTCAAGCTGG + Intronic
1036999764 8:13704470-13704492 GTCTCAACACAGTCTCAAGCTGG + Intergenic
1042717940 8:71795316-71795338 GATTGAAGATAAACTCTAGCTGG + Intergenic
1044781386 8:95746935-95746957 GAAAGAATCCAGTCTCTAGCTGG - Intergenic
1049832499 8:144710961-144710983 GACTGAACACACTCCCCAGCAGG - Intergenic
1049876508 8:145026327-145026349 GTCTGAAAACTGTCTCTAACTGG + Intergenic
1053271910 9:36755833-36755855 GACTGTGAACACTCTCTAGCTGG + Intergenic
1056579778 9:87882645-87882667 GACTGAGGACTGTCTCTGACAGG + Intergenic
1060807344 9:126586035-126586057 GATGGAAGACAGTAGCTAGCAGG + Intergenic
1190263769 X:48815690-48815712 GTCTGAAGACAGTCTCCCCCAGG - Intronic
1191155420 X:57267498-57267520 CAGTGCACACAGTCTCTAGCAGG + Intergenic
1194164264 X:90495468-90495490 AACTGAAGGCAGTCTCTGGCTGG + Intergenic
1195049616 X:101085302-101085324 GACTAAAGAAAGGCTCTGGCTGG + Intronic
1195491390 X:105474240-105474262 GAATGCAGACAGACTCTAGAAGG + Intronic
1195541519 X:106068181-106068203 GACTGGTGACAAGCTCTAGCAGG - Intergenic
1199511600 X:148628826-148628848 GAATGGTGGCAGTCTCTAGCAGG + Intronic
1199569932 X:149257081-149257103 GACTGGAGACAGTGTCTAGAAGG + Intergenic
1200510525 Y:4073278-4073300 AACTGAAGGCAGTCTCTGGCTGG + Intergenic
1202071953 Y:21001071-21001093 GACAGAAGACAATCTTTACCTGG + Intergenic