ID: 1099624484

View in Genome Browser
Species Human (GRCh38)
Location 12:85051484-85051506
Sequence CTTATTAAGCATTTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099624484 Original CRISPR CTTATTAAGCATTTTGAGCT AGG (reversed) Intronic
900719935 1:4169061-4169083 ATAATTAAGTATCTTGAGCTGGG + Intergenic
902722393 1:18312733-18312755 GTGATTAAGGATTTTGAGATGGG - Intronic
903512675 1:23888090-23888112 CCCTTTAAGCATTTTGAGGTGGG - Intronic
907197567 1:52698951-52698973 CATATAAAGCATTTAGAGCCTGG - Intergenic
907806495 1:57825731-57825753 CTTATTAGGCATTTTGCTCCTGG + Intronic
908065094 1:60394289-60394311 CTTATTATTCATTTTTAGCATGG + Intergenic
909041450 1:70657697-70657719 ACTATTAAGCCTTTTGAGCTTGG - Intergenic
909506054 1:76391233-76391255 ATTAATAAGCATTTTGGGCCAGG - Intronic
916229032 1:162520749-162520771 CTTATTAAGTAGAGTGAGCTGGG + Intronic
916303112 1:163297910-163297932 CTTTTTAAATTTTTTGAGCTGGG + Intronic
917672749 1:177288584-177288606 CTTATTAAGCATTTTCAGCTAGG + Intergenic
918210680 1:182348419-182348441 CATATTAAACATTTTAGGCTGGG + Intergenic
918465098 1:184812973-184812995 CTTATTAACCAATTTTAGCCAGG - Intronic
918862003 1:189840480-189840502 CATATAATGCATTTTGAGCCAGG - Intergenic
920205596 1:204288697-204288719 CTTTCTAAGCAATTTGAGCCTGG + Intronic
920976837 1:210794280-210794302 GTTATTTAGAATATTGAGCTTGG + Intronic
921130574 1:212216103-212216125 GTAATTAAGGATTTTGAGATGGG + Intergenic
924214726 1:241809309-241809331 TAAATTAAGCATTTTGAGGTGGG + Intergenic
1063291485 10:4754425-4754447 CTAATGATGGATTTTGAGCTGGG - Intergenic
1063849900 10:10175870-10175892 TTTCTTAAGCATTTTTGGCTGGG + Intergenic
1065572599 10:27087065-27087087 CTTAATAAGAAGTTTGGGCTGGG - Intronic
1066306417 10:34147496-34147518 CATATTAAGCAATTTGAGTCTGG - Intronic
1066756989 10:38721341-38721363 GTGATTAAGCATCTTGAGATGGG + Intergenic
1068521264 10:58080085-58080107 CTTCTTTAGCATTTTGAACATGG + Intergenic
1072018065 10:91369584-91369606 CCTATTAAGCATTTTCAGCAGGG + Intergenic
1073547751 10:104366206-104366228 CTTATTAACCTGTTAGAGCTGGG - Intronic
1074091680 10:110265583-110265605 CTTATTAGACATTGTGTGCTAGG + Intronic
1074474455 10:113756856-113756878 CTGTTGAAGCATTTTGAGCATGG + Intronic
1076276833 10:129207253-129207275 CTTTTTAAGCTATTTGAACTTGG - Intergenic
1082079674 11:48002509-48002531 CTTATTGAGCACTTTGTGCTAGG + Intronic
1082777721 11:57260308-57260330 CTTGTTAAGAATTTTAGGCTGGG - Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1084900748 11:72308136-72308158 CTTCTTTAGCATTTACAGCTAGG + Intronic
1085767450 11:79295472-79295494 TTTAGGAAGCACTTTGAGCTGGG - Intronic
1086334755 11:85789114-85789136 TTTATTTATCATTTTGAGATAGG + Intronic
1087956994 11:104300603-104300625 GTGATTAAGTATTTTGAGATGGG - Intergenic
1089686721 11:120154369-120154391 ATTGTTAAGGATTTTGAGATGGG - Intronic
1091189442 11:133678517-133678539 CTCATTAAGTATATTGAGGTGGG - Intergenic
1093321528 12:17720462-17720484 CTTTTTGAGCTTTTTGAGCCAGG + Intergenic
1093378608 12:18462057-18462079 CTAAGTAAGGATTTTGAGATGGG - Intronic
1093751281 12:22803330-22803352 GTTATTAAGTATCTTGAGATGGG - Intergenic
1094022270 12:25926904-25926926 CTTTTTAACCATGTTGACCTCGG + Intergenic
1094486843 12:30932122-30932144 CTTTTCCTGCATTTTGAGCTAGG - Intronic
1094511553 12:31100312-31100334 CTTATTCAGTAGTTTGGGCTGGG + Intronic
1096339791 12:50788014-50788036 CTTCTTTAGCATTTGGAGTTTGG + Intronic
1098222347 12:68283438-68283460 TTTACTAAGCAATTAGAGCTTGG - Intronic
1098431013 12:70420329-70420351 GTGATTAAGGATTTTGAGATGGG + Intronic
1098431624 12:70425841-70425863 TTTAAAAAGCATTTTTAGCTGGG + Intronic
1099624484 12:85051484-85051506 CTTATTAAGCATTTTGAGCTAGG - Intronic
1100053542 12:90481017-90481039 CTTATTATGCATTTAGTGATGGG - Intergenic
1101547337 12:105728197-105728219 CTTATTAAGCAGTGTGAAGTGGG - Intergenic
1104432247 12:128725949-128725971 ATAATTAAGGATTTTGAGATGGG + Intergenic
1104588997 12:130069398-130069420 ATTATGCAGCATTTTGTGCTAGG - Intergenic
1108213667 13:48162510-48162532 CTTATTAAGCATTCTGTGTGTGG - Intergenic
1108368506 13:49742985-49743007 GTGATTAGGCATTTTGAGATGGG + Intronic
1110327071 13:74229267-74229289 CTTATTATGTATTTTTATCTTGG - Intergenic
1112254432 13:97816542-97816564 CTTACTGAGGATTTTGAGCTTGG + Intergenic
1113033325 13:106018539-106018561 CTTATTAAATATTTTTAGATAGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114369991 14:22076255-22076277 ATTATTAAGGATCTTGAGATGGG - Intergenic
1116503920 14:45654616-45654638 TTTTTTAAGCTTTTTAAGCTAGG - Intergenic
1118421858 14:65614765-65614787 ATAATTAAGGATTTTGAGATTGG - Intronic
1119629590 14:76216247-76216269 CTTGTTAAACATTTTTAGGTTGG - Intronic
1119697903 14:76728538-76728560 CTTTTTAAGGTTTTTCAGCTGGG - Intergenic
1126074957 15:44900311-44900333 GTTATTAAGTATCTTGAGATGGG + Intergenic
1126083407 15:44987504-44987526 GTTATTAAGTATCTTGAGATGGG - Intergenic
1127104868 15:55602906-55602928 ATTATTAAGCTGTTAGAGCTAGG - Intergenic
1127511975 15:59651470-59651492 CATATTAAGTATTTCCAGCTGGG - Intronic
1129931854 15:79417888-79417910 CTTCTTAAGGATTTTGAACACGG + Intronic
1131645116 15:94333366-94333388 CTTATTAAGCTTTTCTAGATGGG + Intronic
1133472835 16:6092225-6092247 CATGTGAAGCATTTAGAGCTTGG - Intronic
1133773546 16:8881606-8881628 CTTATTCAGCTTTATGAGCTTGG - Intergenic
1134392237 16:13830688-13830710 TTTTTTCTGCATTTTGAGCTTGG + Intergenic
1135385872 16:22039353-22039375 CTTGTTAGGGATTTTCAGCTGGG + Intronic
1135844611 16:25907656-25907678 CTAATCAAGCACTTTGAGCAGGG - Intronic
1136720531 16:32316390-32316412 GTGATTAAGCATCTTGAGATGGG - Intergenic
1136725591 16:32354782-32354804 GTGATTAAGCATCTTGAGATGGG - Intergenic
1136838911 16:33522672-33522694 GTGATTAAGCATCTTGAGATGGG - Intergenic
1136843919 16:33560844-33560866 GTGATTAAGCATCTTGAGATGGG - Intergenic
1137015548 16:35370660-35370682 CCCAATAAGGATTTTGAGCTGGG + Intergenic
1138099544 16:54241535-54241557 CTTCTTAAGCTGTTTGATCTTGG + Intergenic
1138763230 16:59568758-59568780 CTTTTTAAACATTTTAAGCTAGG + Intergenic
1138962825 16:62047707-62047729 ATTATTAAGCAATGTGACCTTGG - Intergenic
1203000841 16_KI270728v1_random:162972-162994 GTGATTAAGCATCTTGAGATGGG + Intergenic
1203005901 16_KI270728v1_random:201380-201402 GTGATTAAGCATCTTGAGATGGG + Intergenic
1203132442 16_KI270728v1_random:1699377-1699399 GTGATTAAGCATCTTGAGATGGG + Intergenic
1203149074 16_KI270728v1_random:1822959-1822981 GTGATTAAGCATCTTGAGATGGG - Intergenic
1203154084 16_KI270728v1_random:1861143-1861165 GTGATTAAGCATCTTGAGATGGG - Intergenic
1146003577 17:29146847-29146869 CTTTTTAAGCCAGTTGAGCTGGG + Intronic
1146103495 17:30009136-30009158 GTGATTAAGGATTTTGAGATGGG - Intronic
1149270797 17:54975300-54975322 ATTATTAAGAATTTTTAGCAGGG - Intronic
1150612489 17:66745037-66745059 CAAATTAAGGATCTTGAGCTAGG - Intronic
1150672850 17:67217096-67217118 CTTACTCAGCATCTTCAGCTGGG + Intronic
1151411628 17:73934221-73934243 ATGATTAAGAATTTTGAGATGGG - Intergenic
1151554486 17:74839717-74839739 TTTATTGAGCATTTTGGGCTGGG - Exonic
1153225564 18:2897202-2897224 CTATTGAAGGATTTTGAGCTGGG + Intronic
1154009449 18:10562634-10562656 TTTCTTAAACATTTTCAGCTGGG - Intergenic
1155891420 18:31275191-31275213 CTGAATAAGCAGTTTTAGCTTGG + Intergenic
1158274538 18:55752521-55752543 ATTATTAAGCAAATTGATCTGGG - Intergenic
1160166753 18:76519956-76519978 TTCATTAAGCTTTTTAAGCTGGG - Intergenic
1163393575 19:17045522-17045544 TTTATTAAGCATTTCCATCTAGG + Intergenic
1163457366 19:17415471-17415493 CTTATGAAGGATTTAGAGCCCGG + Intronic
1164003529 19:21129125-21129147 CCCTTTAAGCATTTTGAGGTGGG - Intergenic
1165604671 19:37091628-37091650 CATATTAAGAACTTTGGGCTGGG + Intronic
1165604765 19:37092415-37092437 CATATTAAGAACTTTGGGCTCGG + Intronic
1167900180 19:52615659-52615681 GTTTTTATGCATTTTGATCTTGG + Intronic
926356502 2:12045576-12045598 CTTTTTAGTCATTTTCAGCTGGG + Intergenic
926529361 2:14023418-14023440 ATTATTAAGCTTTTTGGTCTTGG - Intergenic
927157686 2:20230987-20231009 GTGATTAAGAATTTTGAGATAGG - Intergenic
930706612 2:54510589-54510611 CTTTGAAAGCATTTTGAGATAGG + Intronic
930898829 2:56479488-56479510 GTGATTAAGAATTTTGAGATGGG + Intergenic
931350135 2:61480158-61480180 CATATGAAGAATTTTTAGCTGGG - Intronic
931372292 2:61674898-61674920 CTTCTTAAGTATTTTAAGTTTGG - Intergenic
931717871 2:65043406-65043428 ATTGTTAAGCATCTTGAGGTAGG - Intergenic
934320295 2:91965784-91965806 GTGATTAAGCATCTTGAGATGGG + Intergenic
935083721 2:99824408-99824430 AATATTAAGGATTTTGGGCTGGG - Intronic
935471058 2:103461487-103461509 GTAATTAAGTATTTTGAGATGGG - Intergenic
937620966 2:123984557-123984579 CTTGTTAAGAATGTTGACCTTGG - Intergenic
937700217 2:124855645-124855667 CTAATTCAGTATCTTGAGCTGGG - Intronic
939122239 2:138131393-138131415 CGTATTAAGCATTTAGAACTTGG + Intergenic
939142324 2:138369737-138369759 CTTATCTAGCATTGTGACCTAGG - Intergenic
941270183 2:163416403-163416425 ATTATTAATGATTTTAAGCTTGG - Intergenic
943564700 2:189503984-189504006 CTGATTAGGCATTCTGAACTGGG - Intergenic
943816643 2:192265860-192265882 CTTCCTAAGAATTTTCAGCTGGG - Intergenic
944052262 2:195483739-195483761 CTAATTTATGATTTTGAGCTTGG + Intergenic
945338000 2:208615733-208615755 CCTTTTAACCATTTTGAGGTGGG + Intronic
1169180052 20:3556306-3556328 GTTATTGAGCTTTTTGTGCTTGG + Intronic
1169519026 20:6351347-6351369 ATTATTAAGTATTGAGAGCTTGG + Intergenic
1171241285 20:23569012-23569034 TTTATCAACCATTTTGACCTGGG + Intergenic
1172669206 20:36622821-36622843 GTGATTAAGGATTTTGAGGTGGG - Intronic
1173129944 20:40382822-40382844 CTTGTTAGGCATTTAGAACTGGG - Intergenic
1174161622 20:48554983-48555005 TAAATTAAGCATCTTGAGCTGGG + Intergenic
1174366060 20:50057277-50057299 CTTATGAAACCTTTTGTGCTGGG - Intergenic
1176937934 21:14888120-14888142 CTTATTATCAATTTTAAGCTTGG - Intergenic
1176991378 21:15501107-15501129 TTTACTAAGCATCCTGAGCTGGG - Intergenic
1177438006 21:21081503-21081525 CTTATTAAGAATTCTCAACTGGG + Intronic
1178348118 21:31849613-31849635 TGTATTAAGAATTTTGGGCTGGG + Intergenic
1178737223 21:35163257-35163279 CTTATTAACCTTATTGATCTGGG + Intronic
1180308544 22:11149829-11149851 GTGATTAAGCATCTTGAGATGGG + Intergenic
1180547021 22:16511642-16511664 GTGATTAAGCATCTTGAGATGGG + Intergenic
1182212157 22:28685693-28685715 GTGATTAAGCATCTTGAGATGGG - Intergenic
1183970805 22:41476110-41476132 GTTATAAAGCATTGTGAGCCGGG + Intronic
1184279866 22:43430925-43430947 CATATTAAGAATTTCAAGCTTGG + Intronic
949587433 3:5455529-5455551 TTGATTAAGCAGTTTGAGTTGGG + Intergenic
949606346 3:5658455-5658477 CTGATTGAGGATTTTGAGATGGG - Intergenic
950757163 3:15184859-15184881 CTTATCAAGCCTTAAGAGCTTGG - Intergenic
951095070 3:18619913-18619935 CTTATTAACAATTTTGAGAGAGG - Intergenic
951164861 3:19472938-19472960 GTTATTAAGTATTATGAGCAAGG + Intronic
953401609 3:42626310-42626332 CTTATAAAGCATTTTGTTCATGG + Intronic
956286078 3:67612051-67612073 CTTATTAAGAATTTGTAGCTGGG + Intronic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
957775075 3:84748073-84748095 CTTCTTAAGCATTTGCTGCTGGG - Intergenic
957804270 3:85126534-85126556 CTTTTTAAGAATGTTTAGCTTGG + Intronic
957915542 3:86683189-86683211 CTTATGAACCATTTGGATCTTGG + Intergenic
957943135 3:87030397-87030419 TTTACTAATCATTTTGGGCTTGG - Intergenic
958059440 3:88460789-88460811 TTTATTAAACATTTTGAGGATGG + Intergenic
958690858 3:97464345-97464367 TTTACTAAGAATTTTGAGGTTGG + Intronic
959572077 3:107895474-107895496 CTTATTAAGGACTTACAGCTGGG + Intergenic
960008155 3:112803203-112803225 ATTTTTCAGCATTCTGAGCTAGG + Intronic
964177030 3:153836347-153836369 GTTATTCAGCATTTCCAGCTTGG + Intergenic
964954672 3:162337937-162337959 ATTGTTAAACATTTTGAGTTGGG + Intergenic
965099944 3:164283451-164283473 CATGTTAAGCAATTTAAGCTAGG + Intergenic
965763253 3:172103510-172103532 CTTTTTAAACATTTTTGGCTTGG - Intronic
965779075 3:172264666-172264688 TTTATTTTGCATTTTGAACTGGG + Intronic
966131520 3:176645890-176645912 GTGATTAAGGATTTTGAGATGGG - Intergenic
966236490 3:177707073-177707095 CTTATTTAGGATTTTGTGCTTGG + Intergenic
971322253 4:25615096-25615118 CTTATTAAGAATTTCGGGCCAGG + Intergenic
971447095 4:26762668-26762690 GTTATTAACAATTTTGAGATGGG + Intergenic
973107617 4:46360134-46360156 CTTATTTAGCATTTTGATTGTGG + Intronic
974341687 4:60621753-60621775 TTTATTAAACAATTTGAGTTTGG - Intergenic
975183109 4:71369673-71369695 CTTTTTAAAAATTTAGAGCTTGG + Intronic
975612501 4:76215872-76215894 TTTATTTTGCATTTTGAGCAGGG - Intronic
977057880 4:92216403-92216425 CCTATTTAACATTTTGAGTTTGG + Intergenic
977542356 4:98331784-98331806 TTAATTTAGAATTTTGAGCTTGG + Intronic
977873950 4:102127360-102127382 CTTATGAAGAATTTTTAGATTGG - Intergenic
978655728 4:111063264-111063286 CTTAATTAGCTTTTTGACCTTGG - Intergenic
979175164 4:117653290-117653312 TAAATTAAGCATTTTGAGGTGGG - Intergenic
979381014 4:120006823-120006845 CTTGTTAAGTATTTTAAACTTGG + Intergenic
979845862 4:125510790-125510812 GTGATTAAGCATCTTGAGATAGG - Intergenic
980163529 4:129196809-129196831 TTTAATAAGCATATTGAGCAAGG - Intergenic
980462530 4:133135001-133135023 CTTATTTTGCATATTTAGCTAGG - Intergenic
984356985 4:178673741-178673763 CTTATTGAGCACATTGAGCCTGG + Intergenic
984949554 4:184996809-184996831 ATTATTATGTATTTTGAGATAGG - Intergenic
986053757 5:4115295-4115317 ATTATAAAGAATTTTGGGCTTGG + Intergenic
988242066 5:28625671-28625693 CCTATTCAAGATTTTGAGCTGGG - Intergenic
988339088 5:29946025-29946047 CTTATTAGACATTTTTAGTTAGG + Intergenic
988814464 5:34820282-34820304 ATAATTAAGGAGTTTGAGCTGGG + Intronic
988963992 5:36397371-36397393 CTTAAGAAGCAGTTTGATCTGGG + Intergenic
991556826 5:67904494-67904516 GTAATTAAGCATATTGAGATGGG + Intergenic
991966439 5:72096160-72096182 GTGATTAAGGATTTTGAGCTGGG - Intergenic
993946209 5:94119834-94119856 CTTATTAAAGATTTTGATCAGGG - Intergenic
994839510 5:104904783-104904805 ATTATTAAGCACATTGAGTTGGG + Intergenic
995448315 5:112271834-112271856 CCTATTAAGCACTTTTAGGTAGG - Intronic
996066131 5:119081247-119081269 CTTTTTGAGGATTTTAAGCTGGG - Intronic
996479073 5:123952916-123952938 CTTATTAGGCATTTTTGGTTTGG + Intergenic
996848606 5:127928516-127928538 GTGATTAAGAATTTTGAGATGGG - Intergenic
998461853 5:142315302-142315324 ATTATTAATCATCTTAAGCTTGG - Intronic
998473489 5:142401477-142401499 CTATTTAAGAATTTTGGGCTGGG + Intergenic
999361228 5:150988365-150988387 CTTGTTAAGCATAGTGAGGTTGG + Intergenic
1000058467 5:157631463-157631485 GCTTTTAAGAATTTTGAGCTGGG + Intronic
1000769242 5:165331450-165331472 CTTTTTATTCATTTTGATCTTGG - Intergenic
1002840720 6:903027-903049 CTTCTTAATCCTTTTGAACTAGG - Intergenic
1004677436 6:17857011-17857033 TTTATTAAGCATTTTGTACTAGG - Intronic
1004870557 6:19899891-19899913 TTTATTAAGAAGTTTGGGCTGGG - Intergenic
1008712439 6:54244572-54244594 ATTATCAATCATTTTTAGCTAGG + Intronic
1008856203 6:56090616-56090638 CTTATAATGCATTTTGAAATAGG - Intronic
1009904998 6:69859416-69859438 CTCATAAGGCCTTTTGAGCTTGG - Intergenic
1010794721 6:80106148-80106170 CTTATTAAGCATTTTAAGGAGGG + Intergenic
1012326161 6:97920590-97920612 CTTATTCAGAATTTTTAGCAAGG - Intergenic
1013311075 6:108894360-108894382 CTTATTTATTATTTTGAGATAGG - Intronic
1013743753 6:113320298-113320320 ATGATTAAGGATTTTGAGATGGG + Intergenic
1014616632 6:123609525-123609547 TTTATCAAGCAGTTTGAGATTGG - Intronic
1014735309 6:125087751-125087773 CTTATTAAGTATTATTTGCTAGG - Exonic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1019265371 7:113514-113536 CTTATTAAGCTTTTTCAGCATGG + Intergenic
1019956955 7:4423302-4423324 CTTAATAAACCTTTTGAGGTTGG - Intergenic
1020482171 7:8675236-8675258 TATATTAGGCATTTTGAGGTAGG - Intronic
1020691118 7:11355646-11355668 CTGCTTAAGCAATTTGAGTTAGG + Intergenic
1020951221 7:14680228-14680250 TTTATTAATAATTTTGAACTTGG + Intronic
1021161396 7:17277610-17277632 ATTTTAAAGCACTTTGAGCTGGG - Intergenic
1021635883 7:22692419-22692441 CTCATTAAGAATTTTTACCTGGG - Intergenic
1022528123 7:31051470-31051492 CTTATTAAGCCATTTGCACTAGG + Intergenic
1022680403 7:32539970-32539992 ATGATTAAGGATCTTGAGCTAGG - Intronic
1023304306 7:38807874-38807896 ATTCTTAAGTATTTTGAGCAAGG - Intronic
1023326714 7:39068920-39068942 CTTATTTAGCAGTTTGAGGAAGG + Intronic
1026439558 7:70432185-70432207 CATTTTAAGCATTTTGACATCGG - Intronic
1027363161 7:77430203-77430225 CCTATAAAGCTTTTTGAGCAAGG - Intergenic
1027762569 7:82298717-82298739 CTCATTAGACATTTGGAGCTGGG - Intronic
1028311721 7:89346430-89346452 CTTAATTAGCATTTTGAATTAGG + Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1030908405 7:115214802-115214824 ATGATTAAGGATTTTGAGATGGG - Intergenic
1031279830 7:119784215-119784237 TTTATGAAACATTTTAAGCTAGG + Intergenic
1031645929 7:124224690-124224712 ATTATTAAGCAATTTGTGCCAGG + Intergenic
1031806049 7:126307203-126307225 CCTATTAAGAAATTTCAGCTGGG - Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1032121202 7:129158204-129158226 GTGATTAAGAATTTTGAGCTAGG - Intronic
1033187876 7:139245994-139246016 CTTTTGAAGCATTTTGAGCAGGG + Intronic
1034590602 7:152135350-152135372 CTTAATCAGCATTTTGAACCAGG - Exonic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1036527455 8:9548417-9548439 GTGATTAAGGATTTTGAGATGGG + Intergenic
1038459561 8:27704438-27704460 ATTATTATACATTTTGAGGTGGG - Intergenic
1040565270 8:48560366-48560388 CTTGTTAAGCATTTGGAAATTGG - Intergenic
1040927841 8:52703377-52703399 GTTATGAAGCATTTTTAGTTTGG - Intronic
1041974551 8:63782434-63782456 TTTATTAAGCATTTACAGCATGG - Intergenic
1042775069 8:72421129-72421151 CTTATGAAGGATTTGTAGCTCGG - Intergenic
1045983995 8:108226530-108226552 CTTCTTAAACATTTTGGTCTTGG - Intronic
1046210779 8:111072233-111072255 TTTATTTAGAATTTTGAACTTGG + Intergenic
1046266265 8:111834924-111834946 GTGATTAAGCATTTTGAGATGGG + Intergenic
1048137749 8:131762566-131762588 TGTATTTAGCATTTTCAGCTGGG + Intergenic
1050146835 9:2577235-2577257 CTTTTTAAGCTGTTTGATCTTGG - Intergenic
1050236672 9:3588460-3588482 CTTCTTCAACATTTTGGGCTTGG - Intergenic
1051734955 9:20188560-20188582 TTTATTAAGGATTTTGAAATGGG + Intergenic
1052612510 9:30793853-30793875 CTGATTACACATATTGAGCTAGG - Intergenic
1052846066 9:33337567-33337589 TTTAATATGCATTTTCAGCTGGG + Intronic
1055002805 9:71472524-71472546 CTTTTTAAGCATTTTGAGGTGGG + Intergenic
1055643130 9:78336494-78336516 TTTTTTAAGAATGTTGAGCTGGG - Intergenic
1058040081 9:100293622-100293644 CCTACTATGTATTTTGAGCTTGG - Intronic
1058565886 9:106284695-106284717 ATCATTATGCATTTTGAGCCTGG - Intergenic
1059762429 9:117351227-117351249 GGTATTAAGGTTTTTGAGCTGGG - Intronic
1061559862 9:131394901-131394923 ATTATTAAACATTTTTAGCATGG - Intronic
1186835225 X:13430799-13430821 CGTATTAAGCATTTTGGGGAAGG + Intergenic
1190813777 X:53909850-53909872 AATCTTCAGCATTTTGAGCTAGG + Intergenic
1191934422 X:66411129-66411151 CTAATTATGGATTTTGAACTTGG + Intergenic
1192295415 X:69842566-69842588 TTTACTAAGCATCTTGAGCAAGG + Intronic
1192327791 X:70147993-70148015 CTTTTCAAGCATTTTGAGGCTGG + Intronic
1196549315 X:117003294-117003316 TTTCTTACGCATTTTGTGCTAGG - Intergenic
1196806189 X:119588467-119588489 CTTAATAAGCTTTTTGAGAGAGG + Exonic
1196931117 X:120683051-120683073 CTTATTGAACACTTTGTGCTAGG + Intergenic
1198422884 X:136485414-136485436 CTTGTTAATCATTTTTAGCTAGG - Intergenic
1198667197 X:139037743-139037765 GTGATTAAGGATTTTGAGATGGG - Intronic
1199350275 X:146792316-146792338 CTTTTTAAGAATTTTGGGTTTGG - Intergenic
1199382600 X:147187996-147188018 GTTATTAAATATTTTGAGATTGG - Intergenic
1199463258 X:148107232-148107254 TTTCATAAGCATTTTGGGCTTGG + Intergenic
1199663146 X:150072901-150072923 AGTATTAAACATTTTGTGCTTGG + Intergenic
1200822461 Y:7600913-7600935 CTTATTCACCATTTTATGCTTGG + Intergenic
1201187808 Y:11420892-11420914 GTGATTAAGCATCTTGAGATGGG + Intergenic
1201912404 Y:19146217-19146239 CTTATGCAGGATTTAGAGCTCGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic
1202237842 Y:22733104-22733126 CTTATTCACCATTTTATGCTTGG - Intergenic