ID: 1099624571

View in Genome Browser
Species Human (GRCh38)
Location 12:85053580-85053602
Sequence CAGAAAATGGAGGAAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099624571 Original CRISPR CAGAAAATGGAGGAAGAGTC AGG (reversed) Intronic
900597341 1:3487502-3487524 TAGCATATGGTGGAAGAGTCTGG - Intergenic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901243909 1:7713296-7713318 GAGAAAGAGGAGGAAGAGTATGG + Intronic
903116126 1:21179370-21179392 CAGAAAATGAAAGGAGAATCTGG - Intergenic
904104762 1:28069911-28069933 GTGAAAATGGAAGAAGAGACTGG + Intronic
904403293 1:30270788-30270810 CAGAAAAGAGATGCAGAGTCAGG - Intergenic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
906417933 1:45636554-45636576 CAGAAAATGGATGCAGAATATGG - Intronic
906622820 1:47298330-47298352 AAGAAAATAGATGAAGATTCAGG + Intronic
907472072 1:54680417-54680439 CAGCAGCTGGAGGCAGAGTCAGG - Intronic
907816508 1:57923048-57923070 TAGAAAATGGAGAGAGAGACTGG + Intronic
907858807 1:58330270-58330292 CATAGAATTGAGGAAGAGTTGGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
909591106 1:77350537-77350559 CAGTGAATGGAGGAAGCATCTGG + Intronic
909988989 1:82198605-82198627 CAGAAAATGGAGCCACAGTGTGG + Intergenic
910462999 1:87468311-87468333 CAGTAATCGGAGGAAGTGTCAGG - Intergenic
910833337 1:91482452-91482474 GTGAAAATGGAGGCAGAGACTGG + Intergenic
911195462 1:94990163-94990185 AAGAAAATGCAGTTAGAGTCAGG + Intronic
911208913 1:95119293-95119315 CAGAAAATCAAGGAAAAGACAGG - Intronic
911420859 1:97638752-97638774 GAGAGAAAGGAGGAAGTGTCGGG + Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
911846708 1:102762058-102762080 CAGATAAGGGAGTATGAGTCAGG - Intergenic
912961423 1:114198810-114198832 GAGAAAATGGAGGATCAGACTGG + Intergenic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913250593 1:116909811-116909833 CAGGTAACGGAGGAAGAGCCGGG - Intergenic
914418645 1:147508267-147508289 CAGAAAGGGGATGAAGAATCTGG - Intergenic
914425963 1:147576634-147576656 CAGAAAACTCAGGAAGATTCAGG - Intronic
914880845 1:151545620-151545642 CAAGGGATGGAGGAAGAGTCTGG + Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915808328 1:158878331-158878353 TAGTAGGTGGAGGAAGAGTCAGG + Intergenic
916142030 1:161708262-161708284 ATGAAAAAGAAGGAAGAGTCTGG - Intronic
916451961 1:164929270-164929292 CTGAAAATGGTGCAAGAGTAGGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917449254 1:175133317-175133339 AAGAAAATGGAGGCAGAGTTGGG - Intronic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918134961 1:181663615-181663637 CAGAGAACTGAGGAAGAGGCTGG + Intronic
918363715 1:183784664-183784686 CAGATACTGGAGAAACAGTCAGG + Intronic
918650334 1:186955001-186955023 GAGGAAATGGAGGAAGAGAAGGG + Intronic
919624345 1:199896552-199896574 CACAAAAGGGAGGAAAAGGCTGG - Intergenic
919824788 1:201495768-201495790 CTGAATCTGGAGGAAGAGTGGGG - Intronic
919922642 1:202175642-202175664 CAGAAAGAGCAGGAAGACTCAGG - Intergenic
919969438 1:202564310-202564332 GAGAAAATGAAGGAAGGGTAGGG - Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920281077 1:204844101-204844123 TAGAATATGGAGCAAGAGCCAGG + Intronic
920820104 1:209372262-209372284 CAGGAAATGGAGGAAGTGGAAGG + Intergenic
921284293 1:213595143-213595165 CACAAAGAAGAGGAAGAGTCTGG - Intergenic
921907562 1:220511314-220511336 AAGCAAATGGAGGATGAGACAGG + Intergenic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
922737506 1:227995517-227995539 CAGCAAATGGACCAAGATTCAGG - Intergenic
923097652 1:230788375-230788397 CAGCAGGTGGAGGAAGAGCCTGG - Intronic
923504847 1:234596353-234596375 CAGAAACGGGAGGAACAGTCTGG + Intergenic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
1062972485 10:1659794-1659816 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972515 10:1659915-1659937 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1062972546 10:1660036-1660058 CAGGCAATGGAGGAAGAGGGTGG - Intronic
1063823109 10:9860665-9860687 CAGAAAGTAGATGAAGTGTCAGG - Intergenic
1065170698 10:23024343-23024365 AAGAAAATGGTGAAAGAATCTGG + Intronic
1065646997 10:27845624-27845646 GACAAATTGGATGAAGAGTCAGG + Intronic
1065850427 10:29783131-29783153 AATAAAAAGGAGGAAGAGACAGG - Intergenic
1066301680 10:34102661-34102683 CAGAGCATGGAGGCAGAGTTGGG - Intergenic
1066353540 10:34660195-34660217 CACACAATGGAGGGAGAGGCAGG - Intronic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1069950687 10:72016202-72016224 GAAAAAAGGGAGGAAGAGGCTGG + Intergenic
1070687027 10:78492654-78492676 CAGAAAGAGGAGGCAGAGACTGG + Intergenic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071202021 10:83229825-83229847 AATGAAATGGAGGCAGAGTCGGG - Intergenic
1071316726 10:84408413-84408435 CAAAAAATGGAGGGAGAGAGAGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1073814346 10:107189521-107189543 CAGAAAATATAGGAAAAGGCTGG - Intergenic
1073986292 10:109213684-109213706 CAGAAAATAGAGGAAGCTTGAGG + Intergenic
1074171336 10:110941286-110941308 CAGAAAATGGGCAAAGACTCAGG - Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074554643 10:114477074-114477096 TAGGAAAGGGATGAAGAGTCAGG + Intronic
1074994975 10:118748938-118748960 AAGGAAAAGGAAGAAGAGTCAGG + Intronic
1075490484 10:122863765-122863787 CTGAAAATGGAAAAACAGTCAGG - Intronic
1075680992 10:124331056-124331078 ATGAAAATGGAGGCAGAGACTGG + Intergenic
1076034856 10:127191013-127191035 CAGAGAGTGGAGGCATAGTCTGG - Intronic
1076579551 10:131497551-131497573 CAAAAATTGGAGGAAAATTCAGG + Intergenic
1076709431 10:132323720-132323742 CAGAAAATGGACCAAGACACTGG - Intronic
1078704205 11:13723478-13723500 GAGAAAATGGAAGACGAGCCAGG - Intronic
1078776223 11:14396123-14396145 CAGAAAGTGCAAGATGAGTCTGG + Intergenic
1079274270 11:19019118-19019140 CTGAAAATGGAGTCAGAGTCGGG + Intergenic
1080772956 11:35359790-35359812 CAGAGAAAGGAGTAAGAGTTGGG - Intronic
1082006591 11:47422727-47422749 CAGGAAAAGGTGGTAGAGTCAGG + Intronic
1082708091 11:56518376-56518398 CAGGAAATGTAGGGAAAGTCTGG - Intergenic
1082965138 11:58959372-58959394 AAGAAAAGGGAAGAAGAGGCAGG - Intronic
1085699700 11:78735162-78735184 CTGCAAAGGGTGGAAGAGTCAGG - Intronic
1086156097 11:83667681-83667703 CAGAAATTAAAGGAAGAGGCCGG + Intronic
1086168949 11:83813564-83813586 CAGAAAATGGAGACTGAGTAAGG + Intronic
1086434542 11:86768448-86768470 CAGAAAATGGACTAAGACACTGG + Intergenic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1087998434 11:104841687-104841709 CAGTAAAATGAGGAAGAATCTGG - Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088568228 11:111195840-111195862 AAGAGAATGGAGGCAGAGACTGG + Intergenic
1088990341 11:114948291-114948313 TACAAAATGAAGGAAGAGCCTGG + Intergenic
1089048139 11:115521699-115521721 CAGAAAATAAAGGAAGAGAAAGG + Intergenic
1089356638 11:117858232-117858254 CAGAAAAAGGAGGGACAGTTTGG - Intronic
1089716394 11:120364102-120364124 CAAAAAAGTGAGTAAGAGTCAGG - Intronic
1090295066 11:125580226-125580248 CAGAAAATGGAGGCCCAGTTTGG + Intronic
1090352950 11:126119191-126119213 CAGCAAATCTAGGAAGGGTCTGG + Intergenic
1090809218 11:130221977-130221999 GAGAAAATGGAGCAAGAATTAGG - Intergenic
1090874349 11:130775474-130775496 CAGAAAAAGTAGGAAGCATCTGG - Intergenic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1091438529 12:494497-494519 TAGAAAATGGAGGAAGAGGGAGG - Intronic
1091997101 12:5002250-5002272 CAGGAGATGGAGGAACAGTGTGG + Intergenic
1093113981 12:15186922-15186944 CAGAAAATGGAGGAGAACTTGGG + Intronic
1093427838 12:19049008-19049030 TAGAAAATACAGGAAGAGCCTGG + Intergenic
1093516971 12:19999367-19999389 CAGAATTTGAACGAAGAGTCTGG - Intergenic
1093969358 12:25360840-25360862 CAGAAAAGGGAGCAAGAAACTGG - Intergenic
1094433647 12:30397793-30397815 CAGAGCCTGGAGGAAGAGCCAGG + Intergenic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1095536457 12:43254103-43254125 TTGAAAAGGGAGGAAGAGACTGG + Intergenic
1095615607 12:44184431-44184453 CAGAAAAAGGCAGAAGAGTTAGG + Intronic
1096168585 12:49447224-49447246 AAGAAAATAGAAGAACAGTCTGG - Intronic
1096707079 12:53429095-53429117 CAAAAGAGGGAGGAAGAGCCGGG + Intronic
1097158016 12:57026795-57026817 CAGAAAAGAGAGGCAGAGACAGG + Intronic
1097695086 12:62767865-62767887 GAGGAAATGGAGGTAGAGACGGG - Intronic
1097708026 12:62888243-62888265 TATAAAATGGAGGGAGAGGCAGG + Intronic
1097917278 12:65034392-65034414 GACAAATTGGATGAAGAGTCAGG - Intergenic
1097924513 12:65112661-65112683 CAAATAATGGAGAGAGAGTCTGG - Intronic
1098128683 12:67325453-67325475 CAGCAAATGGAGGTAGTGCCTGG + Intergenic
1098249826 12:68558019-68558041 CAGAAAATGGAAGTTGAGGCTGG - Intergenic
1098952094 12:76650244-76650266 AAGAAAATGAAGGAGGAGTGAGG - Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1099958191 12:89371630-89371652 CAGAAGCTGGAAGCAGAGTCAGG - Intergenic
1100168287 12:91943480-91943502 GAGAAAATGGAGGATGACTGTGG + Intergenic
1100217434 12:92466813-92466835 CATGAAATGGTGAAAGAGTCAGG - Intergenic
1100542309 12:95568926-95568948 AAGAAAATGGAGGCAGTGGCCGG - Intergenic
1101840791 12:108326132-108326154 AAGAAAAGGGAGGAAGAGAGAGG + Intronic
1101916611 12:108900842-108900864 CAGAAAATGGAGGATAATTGAGG + Exonic
1102420859 12:112801743-112801765 TGAAAAATGGAGGAAGAGGCGGG - Intronic
1102559296 12:113750667-113750689 AAGAAGATGGAGGCAGAGACTGG - Intergenic
1102784398 12:115592501-115592523 AAGAAAATGGAGGCAAAGTTTGG - Intergenic
1103514945 12:121501425-121501447 AAGAAAATGAAGGCAGAGACTGG + Intronic
1104012245 12:124940035-124940057 CCGAAAAAGGCGGAAAAGTCTGG - Intergenic
1104373244 12:128242913-128242935 GAGAAAAAGGAGGCAGAGTGAGG + Intergenic
1104676991 12:130717799-130717821 CAGAAAATCGTGGAAGGGACTGG + Intergenic
1104695176 12:130858049-130858071 CTGAAGATGGAGGATGGGTCAGG - Intergenic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1105472671 13:20706244-20706266 CTGGAAATGGAGGAAGAGAGAGG - Intronic
1105588298 13:21765350-21765372 CAGAAAGTGCAAGATGAGTCTGG + Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1106253350 13:28000960-28000982 GAGAGATTGGAGGAAGAGTTAGG + Intergenic
1106350417 13:28924206-28924228 AAGAGAATGGTGGAATAGTCAGG - Intronic
1106564903 13:30875662-30875684 AAGAAGATGGAGGCAGAGGCTGG - Intergenic
1107900333 13:45006199-45006221 CAGAAAACAGAGGAAAAATCAGG + Exonic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1109812179 13:67527689-67527711 CAAAAAATGGAGACAGAATCTGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110329829 13:74258756-74258778 AAGAAAATTGAGGAAGAGTGGGG - Intergenic
1110400893 13:75090788-75090810 AACAAAAATGAGGAAGAGTCTGG - Intergenic
1110479995 13:75962762-75962784 CAAAGAAAGGAGGAAGTGTCAGG - Intergenic
1110809416 13:79795002-79795024 CAGAGAGTTGAGGAAGAGCCAGG - Intergenic
1111794121 13:92895990-92896012 CAGAAAATGGACCAAGACACTGG - Intergenic
1111971969 13:94926052-94926074 TAGCAAATGAAGGAAGAGACTGG + Intergenic
1112950842 13:104994658-104994680 TAGACAATGGAGCAAGAGTGTGG - Intergenic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1114293955 14:21312798-21312820 AATAAAAAGGAAGAAGAGTCAGG - Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114815700 14:25955302-25955324 TAGAAAGTGCTGGAAGAGTCAGG + Intergenic
1115139958 14:30159473-30159495 TAGAAGATGGAGGAAGTGTTTGG - Intronic
1115476101 14:33814334-33814356 TAGAAAATGCAGGAAATGTCCGG + Intergenic
1116101690 14:40446153-40446175 AAGAGACTGGAGGAAGAGTGGGG + Intergenic
1116766864 14:49083229-49083251 CAGAAAATGGGGAAAATGTCTGG - Intergenic
1116802770 14:49460451-49460473 CAGAAAATGCAGGAAAATTTTGG + Intergenic
1117516435 14:56506749-56506771 CAGGAAATGTAGGCAGAGGCGGG + Intronic
1117869935 14:60189756-60189778 CAGAAAAAGGAAGAAGGGACTGG - Intergenic
1120179552 14:81329505-81329527 GAGAAGATGGAGGCAGAGACTGG + Intronic
1120728998 14:87980441-87980463 TAGACAATGGAGGAAGAGTGGGG - Intronic
1121518303 14:94568557-94568579 TAGAAAATGGAGGAGGGGCCGGG + Intronic
1121778945 14:96609394-96609416 CTGAAAAGTGAGGAAGAGTCTGG - Intergenic
1122009908 14:98737431-98737453 CAGAACAAAGAGGGAGAGTCAGG + Intergenic
1122618014 14:103034515-103034537 AAGAAAAGGGAGGTAGAGGCTGG + Intronic
1123880252 15:24672281-24672303 CAGTAAAGGGCGGAAGAGTGTGG + Intergenic
1124831806 15:33156110-33156132 GAGAGAAAGGAGGAAGAGTCTGG + Intronic
1126434549 15:48622840-48622862 ATAAAAATGGAGGAAGTGTCTGG - Intronic
1126789510 15:52208191-52208213 TAGATTATGGAGGAACAGTCAGG + Intronic
1128418851 15:67472481-67472503 CAGGAGATGGGGGAAGAGTAGGG + Intronic
1128441666 15:67715168-67715190 CAGAAAAGGGAGTAAGAGCAGGG - Intronic
1128898843 15:71400549-71400571 CAGTCAGTGGAGGAAAAGTCTGG + Intronic
1128911831 15:71522694-71522716 CAGAAAGTCAAGGAAGATTCTGG - Intronic
1129815795 15:78552464-78552486 CAGAAAATAAAGGAAGACTCTGG + Intergenic
1129930558 15:79407125-79407147 CAGCATATAGAGGAAGAGTCAGG - Intronic
1130137599 15:81195169-81195191 CGGAAAATAGAGGGAGAGGCGGG + Intronic
1130246412 15:82253924-82253946 GAGAGAATGGAGGAAGGGTAAGG - Intronic
1130454215 15:84089035-84089057 GAGAGAATGGAGGAAGGGTAAGG + Intergenic
1130567396 15:85008423-85008445 CACAGTATGGAGGAAGGGTCTGG - Intronic
1130684926 15:86028742-86028764 AATAAAATGGAGGAAGAGAAAGG - Intergenic
1130760146 15:86810846-86810868 AACAAAATGGAGCAAGATTCAGG + Intronic
1130894147 15:88157636-88157658 CAGAACATGGGGGAACAGTGGGG + Intronic
1130925344 15:88381475-88381497 CAGAAGATAGAGGTTGAGTCAGG + Intergenic
1131821174 15:96275524-96275546 CAGAAAAAGAAGGAAGCGTGTGG - Intergenic
1133482792 16:6187388-6187410 GAGAAACTAGAGGAAGGGTCAGG + Intronic
1134144407 16:11748654-11748676 CAGAAAATGCAGGGAGAGTTTGG + Intergenic
1134290256 16:12899033-12899055 CACAGAGTGGAGGAAGAGGCCGG + Intergenic
1134343847 16:13371129-13371151 GAGAAAATGGAGGCAGTGTTAGG + Intergenic
1134352909 16:13454551-13454573 CAGATGAGGGAGGAAGACTCAGG + Intergenic
1134509554 16:14834933-14834955 GAGAAAACGAAGGAAGAGGCTGG + Intronic
1134589081 16:15437324-15437346 CAGAAAATGAAGGCAGAGTGAGG - Intronic
1134697259 16:16233749-16233771 GAGAAAACGAAGGAAGAGGCTGG + Intronic
1134807146 16:17135696-17135718 CAGAGATGGGACGAAGAGTCAGG + Intronic
1134904841 16:17971519-17971541 AAGAAGATGGAAGAAGAGACAGG + Intergenic
1134974587 16:18560925-18560947 GAGAAAACGAAGGAAGAGGCTGG - Intronic
1135612867 16:23883584-23883606 CAGAAGTGGGAGGATGAGTCAGG + Intronic
1135765420 16:25173664-25173686 CACACTATGGAGGAAAAGTCCGG - Intronic
1137299321 16:47132344-47132366 CAGTAAATAGAGGAATAGTTAGG - Intronic
1137572103 16:49573363-49573385 CAGAAAATGGAGTAAGACAATGG - Intronic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137763161 16:50957010-50957032 GACAAAATGGAGGAGGAGACAGG - Intergenic
1138499991 16:57435189-57435211 CAAGAAAGAGAGGAAGAGTCGGG - Intronic
1140073833 16:71678031-71678053 CATAAAATGGTGGAGGGGTCGGG + Intronic
1140089174 16:71823047-71823069 CAGAAAAGTTAAGAAGAGTCCGG + Intergenic
1140345521 16:74209328-74209350 AAGAAAATGGAGGAAGAGGGAGG + Intergenic
1140378288 16:74463175-74463197 AGAAAAATGGAGGGAGAGTCAGG - Intronic
1140832558 16:78765235-78765257 CAGAAAGTCCAGGAAGTGTCAGG + Intronic
1141342839 16:83218947-83218969 CAGAAGATGGAGGAAGAACAAGG - Intronic
1141731340 16:85825048-85825070 GAGACAATGGAGGCAGAGACTGG - Intergenic
1141977275 16:87525243-87525265 ATGAAGATGGAGGAAGAGTTGGG - Intergenic
1143416543 17:6755054-6755076 GAGAAAATGGAGGCAGAGAGAGG - Intergenic
1143559448 17:7684005-7684027 CAGAAAACAGAGGAACAGACTGG - Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1146704656 17:34992182-34992204 GAAAAAATGGAGGCAGAGACAGG - Intronic
1147012998 17:37466760-37466782 CAGAGAATGAAGGAAGAGCCTGG - Intronic
1147654347 17:42080373-42080395 CAGGAAATGAAGGGAGGGTCAGG - Intergenic
1148972821 17:51499259-51499281 CAGAAAATGAAGAAAGACTATGG + Intergenic
1149044417 17:52227777-52227799 AAGAAAAAGAAAGAAGAGTCAGG - Intergenic
1150142534 17:62742434-62742456 CACAAAATGGAGTAGGAGCCAGG - Intronic
1151215684 17:72575080-72575102 AAGAAAATGGGAGAAGGGTCAGG + Intergenic
1151292914 17:73163472-73163494 CAGGAAAAGAAGGAAGAGCCAGG - Intergenic
1151331285 17:73410727-73410749 CAGAAACTGGTGGAGGAGTAAGG - Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152493075 17:80650867-80650889 CAATTAATAGAGGAAGAGTCAGG - Intronic
1152984843 18:312059-312081 CAGAGAATGGTGGAAAAGTGTGG + Intergenic
1153171523 18:2321291-2321313 CAGAGAGTGGAGGAAGAATGTGG + Intergenic
1153966421 18:10186734-10186756 CAGAAAATGGAAGTAGGGTATGG + Intergenic
1154371205 18:13764881-13764903 CAAAAAATGGGGGAAGTGCCAGG - Intergenic
1155943154 18:31819911-31819933 CAAAAAATAGAGGAAGAGAAAGG - Intergenic
1156233683 18:35180252-35180274 GAGAAAAAGGAAGAAGGGTCGGG - Intergenic
1157658218 18:49414154-49414176 CAGAAACTGGAGGGAGAGGATGG + Intronic
1157929226 18:51802700-51802722 CAAAAACCGGAGGAAGAATCTGG - Intergenic
1158010365 18:52721073-52721095 CAGATAATGTAGGAAAAATCTGG + Intronic
1158164203 18:54520594-54520616 CAGTAGATGGAGGAAGATCCTGG - Intergenic
1159027455 18:63197484-63197506 CTGAAAATGCAAGAAGAGTTTGG - Intronic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1160886001 19:1348397-1348419 AAGAAAATTGAGGCAGAGACAGG - Intergenic
1160886054 19:1348720-1348742 AAGAAAATTGAGGCAGAGGCTGG - Intergenic
1160965757 19:1746265-1746287 AAGGAAATGGAGGAGGAGTGGGG + Intergenic
1161312217 19:3601048-3601070 ATGAAAATGGAGGAAAAGGCCGG - Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1162419927 19:10560312-10560334 GAGGAAATGGAGGAAGAGGAGGG - Exonic
1162882000 19:13666645-13666667 CAGAAGATGGGGGAAGTGTGAGG - Intergenic
1164427120 19:28151409-28151431 GAGAAAATGGAGGCAGAGTTTGG - Intergenic
1164521990 19:28986403-28986425 GAGAAAATAGAGGAAGAGCCTGG + Intergenic
1164635845 19:29791011-29791033 CTGATAATGAAGGAAGAGGCCGG + Intergenic
1164794294 19:31014024-31014046 GAGAAAGAGGAGGGAGAGTCTGG + Intergenic
1165344167 19:35233313-35233335 CAGAAAGTGGAAGAAGAGGCAGG + Intergenic
1165386211 19:35511979-35512001 AAAAAAAAGGAGGAAGAGACGGG - Intronic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166142855 19:40814376-40814398 AGCAAAACGGAGGAAGAGTCAGG - Intronic
1166184703 19:41132426-41132448 AGCAAAATGGAGGAAGAGTCAGG + Intergenic
1166240990 19:41493589-41493611 CAGCACATGGAGTCAGAGTCAGG + Intergenic
1167107698 19:47440142-47440164 CAGAGATTGGAGTAAGAGTTAGG - Intronic
1167709348 19:51100312-51100334 TTGAAAATGGAGGAAGAGCCGGG + Intronic
1167985723 19:53313481-53313503 CAGAAAAAAGAGGAATAGTTCGG + Intergenic
1168072386 19:53960297-53960319 CAGAAAAGAGAGGAAGGGGCCGG + Intergenic
1168303166 19:55418651-55418673 AAGAAAATGGAGGGAGTGGCCGG + Intergenic
1168344133 19:55642194-55642216 GAGAAAAGGGAAGAAAAGTCGGG + Exonic
1168445465 19:56408252-56408274 TGGAAAATGGAGAAAGAGTAAGG + Intronic
925644698 2:6023872-6023894 TAGACAATGGAGGCAGAGACTGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926778786 2:16448093-16448115 GAGAAGCTGGCGGAAGAGTCGGG + Intergenic
927537044 2:23871532-23871554 AAGAAAAAGGAGACAGAGTCAGG - Intronic
927805066 2:26139750-26139772 CAGAGACAGCAGGAAGAGTCTGG + Intergenic
929654432 2:43716292-43716314 CTGAAACTGGAGGAAAAGTGAGG + Intronic
930231817 2:48850843-48850865 GAGAAACTGGTGGAAGAGGCGGG - Intergenic
931090236 2:58877828-58877850 CAGGAAATGGAGGTAGAGCATGG + Intergenic
931205232 2:60140085-60140107 GAGAAAATGGAGGCAGAGCCAGG - Intergenic
931427277 2:62182734-62182756 CAGAATATGGATGAAGACACTGG + Intergenic
932554702 2:72811524-72811546 CAGAAAATAGATGAGGAGTGAGG + Intronic
932700115 2:73985876-73985898 GAGAAAATGGGGGAAGAGATGGG - Intergenic
932710035 2:74056018-74056040 CAGAAAATGGACTAAGAAACTGG + Intronic
934019876 2:87937189-87937211 CAGAAAAAGCCGGTAGAGTCAGG + Intergenic
934610394 2:95731192-95731214 CATAATATGGAGGAAGAGTGTGG + Intergenic
934919005 2:98326809-98326831 CAGAAAATGGGGGAGGAATAGGG + Intergenic
935131208 2:100262348-100262370 CAGAGAATGGATTAAGAGTCTGG - Intergenic
935373539 2:102372365-102372387 AGGAAAATGAAGGAAGAGTGTGG - Intronic
935863533 2:107360381-107360403 TAGAAAATGGCGGAAGACTGTGG - Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936543729 2:113372771-113372793 CATAACATGGAGGAAGAGTGTGG + Intergenic
936645180 2:114360600-114360622 CTGAAAATGGATGAAGGGGCTGG + Intergenic
936681574 2:114779295-114779317 CAGAAAATCTCAGAAGAGTCTGG - Intronic
937139932 2:119591135-119591157 CAGCAAATGGAGGAACAGCTGGG + Intronic
937743008 2:125377888-125377910 CAGAAAATTGGGGAAGAGAATGG - Intergenic
937905723 2:127051906-127051928 CTGTAAAAGGAGGAAGTGTCTGG + Intronic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
938566545 2:132523883-132523905 CAGAACCTGGGGGAAGAGTTTGG + Intronic
939160981 2:138588471-138588493 GAGTAAGTGGAGGAAGACTCAGG - Intergenic
939442535 2:142267968-142267990 TAGGAAATGGAAAAAGAGTCAGG + Intergenic
939472678 2:142644500-142644522 CAGAAAATATAGCAAGATTCAGG + Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
941524845 2:166594625-166594647 CAGAAAATCAACAAAGAGTCTGG + Intergenic
942041593 2:172069760-172069782 CAGAATATAGAGGTAGATTCAGG - Intronic
942086363 2:172447756-172447778 AGGAAAATGGAGGAGGAGACAGG - Intronic
942396700 2:175557397-175557419 CAGCACATGGAAGAAGAGCCTGG + Intergenic
942516715 2:176761651-176761673 AGGAAAAAGGAGGTAGAGTCTGG - Intergenic
943104622 2:183529099-183529121 CAGAAGCTGGAGCAAGAGGCAGG - Intergenic
943737917 2:191377709-191377731 CAGAAAATTAAGGAATAGCCTGG - Intronic
944161760 2:196669066-196669088 CAGAAAATTGTGGAACAGTTTGG - Intronic
944701599 2:202250933-202250955 TATAAAAAGGAGGAAGAGCCAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
945159425 2:206874047-206874069 CAGAGCATGGAGGCAGAGTCAGG - Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
945978275 2:216287429-216287451 CAGATCATTGAGGAAGTGTCTGG - Intronic
946823664 2:223655160-223655182 CAGAAAAGGGAGAAAGAATAGGG - Intergenic
947289177 2:228552887-228552909 CAGAAAAAGGAAGAAAATTCAGG + Intergenic
947318789 2:228894577-228894599 GAGAAAATGGAAGAAGAATAAGG - Intronic
948252420 2:236540720-236540742 CAGTAAATGGAGGAAAAATGTGG - Intergenic
948270960 2:236672793-236672815 GAGCAAATGTAGGAAGAGGCTGG + Intergenic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1169150608 20:3286565-3286587 TAGAAACCAGAGGAAGAGTCTGG - Intronic
1170255239 20:14335121-14335143 CAGAAAAAGGAGGAAGCCTTAGG + Intronic
1170554506 20:17504634-17504656 CAGAAACTGCAGGAGGGGTCAGG + Intronic
1170580184 20:17693312-17693334 CAGAAAAGGAGGGAAGAGACAGG + Intergenic
1170764509 20:19278752-19278774 CAAAAAATGGAGGAAGGATGTGG - Intronic
1170987883 20:21274856-21274878 CAAAAAATTGTGGCAGAGTCAGG - Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171182981 20:23104520-23104542 CAGAAAATGTAGCCAGAGTCTGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1172566870 20:35937619-35937641 GAGAAAATTAAGGAAGAGTCTGG - Intronic
1173286005 20:41672013-41672035 CAGAAAATGGGAGAAGGGCCTGG - Intergenic
1173674035 20:44818317-44818339 CACAAAATGGAGGAAGAGGCAGG + Intergenic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174276259 20:49406774-49406796 CAGAAGAGGGTGGAAGAGTGAGG - Intronic
1174717719 20:52777685-52777707 TAGAAAATGGAGATAGAGCCAGG - Intergenic
1174845970 20:53943444-53943466 AAGATAATGGAGAAAGAGTATGG + Intronic
1175004668 20:55669694-55669716 CGGGAAATGGAGGAAGAGAGAGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1177224339 21:18234325-18234347 CAGGAAATGGAAGCAGAGTGTGG + Intronic
1177339242 21:19778943-19778965 CAGAAAATGGACTAAGACACTGG + Intergenic
1177774957 21:25557579-25557601 CATATAATGGAGGAAAAGTTAGG - Intergenic
1177952058 21:27551330-27551352 CAGAAGATGAAGGAAGAGCAAGG + Intergenic
1178265671 21:31141167-31141189 CAGAAAATCCATGAAGAGTTTGG - Exonic
1178270586 21:31186112-31186134 TAGAAAAAGGATGAAGAGTTGGG + Intronic
1179588924 21:42392359-42392381 CAGGAGATGGAGGAAGAGCAGGG + Intronic
1179625925 21:42649764-42649786 CAGAGAGTGGAGGCAGAGGCTGG + Intergenic
1180914220 22:19474092-19474114 GAGAAAAGGGAGGAAGAATGTGG + Intronic
1181015966 22:20068948-20068970 CAGGAACTGGGGGAAGAGTGTGG - Intergenic
1182245786 22:28956424-28956446 AAGAGAATGGAAGAAGAGTTAGG - Intronic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183650193 22:39149210-39149232 CAGCAAGTGGAGGCAGAGTTGGG - Intronic
1183653789 22:39173687-39173709 CAGGCAATGGAGAAAGAGCCAGG + Intergenic
1184281939 22:43442366-43442388 CAGGAAAGGGAGGAAGAGCGAGG - Intronic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184978217 22:48078195-48078217 AAGAAGATGGAGGCAGAGACTGG - Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
949256425 3:2052007-2052029 TAGAAAATGGAAACAGAGTCTGG - Intergenic
949813768 3:8036960-8036982 GAGAACATGGAGGAAGAATGGGG - Intergenic
951183330 3:19683791-19683813 CAGAAAGTACAGGAAGACTCTGG + Intergenic
951407507 3:22318312-22318334 GAGAAAATGGATGAAGATGCAGG + Intronic
951732876 3:25829959-25829981 CAGAAAATGGATGAAGACATAGG + Intergenic
951884733 3:27513256-27513278 AAGAAAATGGAGGAAGAAGCTGG + Intergenic
953134356 3:40169980-40170002 CAGCAAGTGGAAGAAGAGCCAGG + Exonic
953730966 3:45447710-45447732 CAGAAAATGGAGGAAGACACAGG + Intronic
953785428 3:45907433-45907455 CAGCAGATGCAGGAAGAGACAGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954631223 3:52048590-52048612 CAGACAATGAAGGGCGAGTCAGG + Intergenic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955507594 3:59647619-59647641 CAGAGATTGGAGGAATTGTCTGG - Intergenic
955813891 3:62821520-62821542 GAGAAGATGGAGGCAGAGACTGG - Intronic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
956373549 3:68589781-68589803 CAGAAAATTGAGGTAAGGTCTGG + Intergenic
959692047 3:109208399-109208421 AAGAAAATGGGTGAAGAGCCAGG - Intergenic
961579129 3:127863752-127863774 AAGAAAATGAAGGAATAGGCCGG - Intergenic
962546720 3:136443921-136443943 CAGAAAATGGGGGTGGAGTAAGG - Intronic
962616823 3:137134915-137134937 CATGGAATGGAGGAAAAGTCTGG + Intergenic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
965927744 3:174003036-174003058 CAGAAAGTTGAGGATGAGTGAGG + Intronic
965980596 3:174685446-174685468 CAGAAAATGGAAGAGAAGTTTGG - Intronic
966379993 3:179335385-179335407 CAGAAATTTGGGCAAGAGTCAGG - Exonic
968462015 4:730967-730989 TAGAAAATGGAAAAAGAGCCAGG + Exonic
968767556 4:2481428-2481450 CAGAAAAGTGAGGACGAGTTGGG + Intronic
968932847 4:3591652-3591674 CAGAAGATGGAGGAAAAGATGGG - Intergenic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
972015842 4:34244358-34244380 CAAAAACTAGAGGAAGAGTCTGG + Intergenic
972601675 4:40578521-40578543 TAGAAAATGGAGGCAGAGGGAGG - Intronic
973766521 4:54168178-54168200 CAGAAAGATGAGGAAGAGCCAGG + Intronic
974574634 4:63702128-63702150 CAGAAACTAGATGAAGAGTTAGG - Intergenic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
977634461 4:99281077-99281099 GAGAAAATGGAGGAAGATACAGG + Intronic
977901630 4:102428758-102428780 CAGAAAATGGAGGCATAGAGAGG - Intronic
979078751 4:116307671-116307693 CAGGAAAAGGAGGCAGAGCCTGG + Intergenic
980034581 4:127869043-127869065 CAAGAAATGGAGGAATAATCAGG + Intergenic
980075760 4:128291062-128291084 CAGTAAATAGATGAAGTGTCAGG - Intergenic
981107496 4:140897510-140897532 GAGAAACTGGAGAAAGAATCTGG + Intronic
982027428 4:151264575-151264597 CAGAGAGTACAGGAAGAGTCTGG + Intronic
982216530 4:153087220-153087242 CAGAGAGAGGCGGAAGAGTCAGG + Intergenic
982351367 4:154419247-154419269 CAGAAAATAGAGTAAGGTTCTGG + Intronic
982833258 4:160089826-160089848 CAGAAGATGAAGGAAGAGCAAGG - Intergenic
984908016 4:184648464-184648486 CTGAGAATGGGGGAAGAGGCAGG + Exonic
984951208 4:185009121-185009143 TAGAAAGTGAATGAAGAGTCAGG - Intergenic
985521606 5:376350-376372 CAGGACATGGAGGCAGAGCCTGG - Intronic
986216325 5:5722554-5722576 AAGAAAATTGAGGAAAAGGCGGG + Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
987073407 5:14358788-14358810 CAGGATATGGAGGCAGAGCCAGG + Intronic
987740936 5:21907854-21907876 CAGAAAATTGAGGTACAGTGAGG - Intronic
988580979 5:32468588-32468610 CAGGACCTGGAGGAACAGTCTGG + Intergenic
989104137 5:37845161-37845183 GAGAAAATGGAGGCAGAGAGTGG + Intergenic
990210476 5:53478586-53478608 GAGAAAAGGGAGGGAGAGTACGG + Intergenic
990989203 5:61668864-61668886 CAGAATCTGGAGGAAGAGCCAGG + Intronic
992101445 5:73411435-73411457 CTGAAAATAGAGGAAAAGTAAGG - Intergenic
993105143 5:83592154-83592176 CAGAAAATGTAGGATTAGGCCGG + Intergenic
993805204 5:92399303-92399325 CAGAGAATGGAGGAAGGGAATGG + Intergenic
994150925 5:96446754-96446776 AAGAGAATAGATGAAGAGTCAGG + Intergenic
994308744 5:98240410-98240432 CAAAAAATGTAAGAAGATTCAGG + Intergenic
996042719 5:118833832-118833854 AAGAAAAGGAAAGAAGAGTCAGG - Intergenic
996105656 5:119499331-119499353 AAGAAAATGGAGGGAGTTTCTGG - Exonic
996611991 5:125393317-125393339 CAGAAAACAGAGGAAGAGAATGG + Intergenic
997871205 5:137506559-137506581 GAGTAAATGGAAGAAGAGCCAGG + Intronic
998318611 5:141208103-141208125 CAGAAAATGAAGCAAGAGATTGG - Intergenic
998534482 5:142916793-142916815 GTGAAAATGGAGGAGGAGTGAGG + Intronic
998873575 5:146576547-146576569 CAGGAAGTTGAGGAAGAGTTTGG - Intergenic
1000638915 5:163677834-163677856 TAGAAAGTGGTGGAATAGTCTGG + Intergenic
1000749505 5:165076096-165076118 TAGAAAATGGAGAAAGAATTTGG + Intergenic
1000889791 5:166788692-166788714 CAAAAAATTGAGGAAGCGTATGG + Intergenic
1001152947 5:169247999-169248021 CAGAGGGTGGAGGAAGAGTGTGG + Intronic
1001219730 5:169890164-169890186 AGCTAAATGGAGGAAGAGTCGGG - Intronic
1001635310 5:173205956-173205978 CATAAAAAGGAGCAAGTGTCTGG + Intergenic
1002455033 5:179341223-179341245 CAGAAAAGGAAAGAAGAGGCCGG + Intronic
1003220305 6:4155241-4155263 CAGAAAACAGAGGAAGGGGCTGG + Intergenic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1004043308 6:12004124-12004146 CAGAAAATGGAGGCACAGGAAGG + Intergenic
1004973399 6:20936965-20936987 AAGAAAATGAAGGCAGAGTACGG - Intronic
1005118700 6:22367046-22367068 AAGACAATGGAGGAGGAATCAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005775902 6:29130430-29130452 CAGAAAGTGGAGGGTGAGTTAGG - Intergenic
1006082275 6:31574524-31574546 GAGAAGATGAAGGAAAAGTCAGG + Intergenic
1006268559 6:32945885-32945907 GAGAAAATGGAGGCAGAGGGAGG + Intronic
1006592145 6:35166187-35166209 CAGAGAATGGGGGAAGAGGGAGG + Intergenic
1006689591 6:35870382-35870404 GAGGAAATGGAGAAAGAGTCGGG - Exonic
1007389359 6:41541389-41541411 CAGGGAATGGAGGAACAGTGGGG + Intergenic
1007474306 6:42108607-42108629 TAGAGAATGGAGGCAGATTCTGG + Intronic
1007477637 6:42129566-42129588 CAGTAACTGGAGGAAGAGGAAGG - Intronic
1007975708 6:46099094-46099116 CAGAAAATGGCTAAAAAGTCAGG + Intergenic
1008883678 6:56409098-56409120 CAGAAAATGGTGGACTATTCTGG + Intergenic
1010773879 6:79863184-79863206 CAGAGAATGGAGGTTGAGTTAGG + Intergenic
1011325094 6:86141958-86141980 GATAAAATGTAGGAAGAATCTGG + Intergenic
1011509341 6:88082735-88082757 CAGAAAATTGAGTAAGAGGATGG + Intergenic
1011850539 6:91622569-91622591 GAAAAAATAGAGGAGGAGTCAGG - Intergenic
1013235317 6:108193488-108193510 CAGGAAACTGAGCAAGAGTCAGG + Intergenic
1013673253 6:112428754-112428776 CAGAAGCTGGAGGCAGAGACTGG + Intergenic
1014055003 6:117003326-117003348 CAGAAATTGGAGGTGGAGTAGGG - Intergenic
1014264069 6:119254360-119254382 CAGAAAAAAGAGGGAGAGTAAGG + Intronic
1014837184 6:126172916-126172938 TATAAAATGTGGGAAGAGTCAGG + Intergenic
1017322150 6:153106460-153106482 AAGAAAAGGGATGAAGAGGCTGG + Intronic
1017547814 6:155470253-155470275 CAGAGCATGGAGGCAGAGACTGG - Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019838753 7:3417332-3417354 CAGAAAGAAGACGAAGAGTCGGG - Intronic
1020565983 7:9796158-9796180 CATAAAATGGAGGAAGAGGAAGG - Intergenic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022032992 7:26508905-26508927 CGGAAAATGGAGGCAAAGGCAGG + Intergenic
1022036305 7:26537857-26537879 GAGAAAATGGAGTAACCGTCAGG + Intronic
1022310873 7:29194782-29194804 CAGGAAGTGCAGGCAGAGTCCGG + Exonic
1022547758 7:31204564-31204586 CAGAAAGAGCAGGAAGAGTGTGG - Intergenic
1023344043 7:39252921-39252943 CAGAAAATGGACAAATACTCAGG - Intronic
1023379897 7:39596628-39596650 CAGAAAATGGTGCCTGAGTCAGG - Intronic
1023420800 7:39977631-39977653 CACAAAATATAGGAAGTGTCAGG - Intronic
1024182428 7:46909516-46909538 CAGAAAATGAAGGAAGAGATAGG + Intergenic
1024454194 7:49584373-49584395 GAGAACATGGAGGCAGAGACTGG + Intergenic
1024843013 7:53609434-53609456 CCTTAAATGGAGGAAGAGCCTGG + Intergenic
1024932661 7:54680023-54680045 CACAGAATGGAGGCAGAGTTGGG + Intergenic
1024944021 7:54790972-54790994 CAGAAAATGAAAGGAGATTCAGG - Intergenic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1026205600 7:68254936-68254958 AAGAAAAAGGAGGAAGAGAAAGG - Intergenic
1026213165 7:68324664-68324686 CAAGAAGTGGTGGAAGAGTCAGG - Intergenic
1026907935 7:74073683-74073705 CACAAAACGGAGGTAGAGCCAGG - Intergenic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1028633901 7:92965942-92965964 CATAAAATGTAGAAAGAGGCTGG + Intergenic
1028822313 7:95226703-95226725 CAGAAAAGGAAAGCAGAGTCAGG - Intronic
1029819291 7:103130437-103130459 GAGAAAATGGAGGATGAGAAAGG - Intronic
1029983444 7:104900462-104900484 CAGAAAATGGCCTAAGAGTCAGG - Intronic
1030937879 7:115608407-115608429 CAGAAAATATAGCAATAGTCAGG - Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031571075 7:123360384-123360406 CATAAAATGGATGAAGATTCTGG + Intergenic
1031795361 7:126167875-126167897 CAGAAAATGGTGGAAAAATTTGG - Intergenic
1032548313 7:132761899-132761921 CTGCAAATGGAGGAAGAGAAAGG + Intergenic
1032566181 7:132948375-132948397 AAGAAAATGGTGGAAGAGTGAGG + Intronic
1033011455 7:137626770-137626792 TAGAAAATGGAGCAAAAATCCGG - Intronic
1033142150 7:138837287-138837309 CAGAAGAAGGAGGAAGAATGCGG + Intronic
1033704917 7:143877065-143877087 CAGAAAATGGGGGCAGAGATTGG + Intronic
1034133516 7:148742897-148742919 CAGAAAAGGTAGAAAGAGTTGGG - Intronic
1035234757 7:157489075-157489097 GAGACAATGGAGGCAGAGGCTGG + Intergenic
1035562899 8:619988-620010 AAGAAAATGGAGGAATAATAAGG + Intronic
1037316709 8:17606028-17606050 CAGCATCTGGAGGGAGAGTCTGG + Intronic
1037862238 8:22413685-22413707 CAGAAAATGGAGGAACAACCCGG + Intronic
1038176363 8:25184798-25184820 CGGAACATGGCGGAAGCGTCTGG + Intronic
1038563911 8:28603684-28603706 AAGAAAAGGCAGGAAGAGTCAGG + Intronic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1039658143 8:39433116-39433138 GAGAAAAAGGAAGAAGAGTGTGG + Intergenic
1040858641 8:51976396-51976418 TTGAAAATGGAGGTAGAGGCAGG + Intergenic
1041589601 8:59561555-59561577 CAGCAACTAGAGGAAGAGACAGG + Intergenic
1041642178 8:60214989-60215011 CAGAAAAAGGAGGAAGAAAAGGG + Intronic
1042479558 8:69287994-69288016 GAGAAAATGGAGGCAGAGATAGG - Intergenic
1042977779 8:74489646-74489668 CAGAGAATGTAAGAAGATTCTGG - Intergenic
1043045313 8:75315486-75315508 CAGAAAGTTGAGGAAGCTTCTGG - Intergenic
1043057721 8:75461292-75461314 CAAAAAATGGAGGAAGACCCTGG - Intronic
1043334157 8:79152074-79152096 CAAAAAATGGAGCAAGAGAGAGG - Intergenic
1044624644 8:94225310-94225332 CAGAAAATGAAGGAATCGTTTGG - Intergenic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1045497815 8:102722942-102722964 GGGAATATGGAGGAAGTGTCAGG + Intergenic
1045558001 8:103233269-103233291 CAGCAATTGGAGAAAGAGACGGG + Intergenic
1047324629 8:123824608-123824630 CATGAACTGGAGGAAGAGGCAGG - Intergenic
1048200445 8:132369710-132369732 CAGCAAATGGTGGTAGAGCCAGG + Intronic
1048648148 8:136444984-136445006 GAGAAAATTCTGGAAGAGTCAGG - Intergenic
1048782236 8:138015054-138015076 CAGATAATTCAGGAAGAGACAGG + Intergenic
1049497707 8:142944262-142944284 GAGAACAATGAGGAAGAGTCTGG - Intergenic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050766716 9:9143371-9143393 TAGAAAGTGGAGGCAGTGTCAGG - Intronic
1051296765 9:15604632-15604654 TAGAAAGAGGAGGAAGAGTAGGG + Intronic
1051299612 9:15634396-15634418 AAGGAAATGGAGGAAGAATCTGG + Intronic
1054457281 9:65440242-65440264 CAGAAGATGGAGGAAAAGATGGG + Intergenic
1054900992 9:70369545-70369567 TAGAAAATGTAGGAAGTGGCAGG + Intergenic
1055298484 9:74858444-74858466 CAGACACTGGAGTAAGAGTAAGG + Intronic
1055862831 9:80774111-80774133 AGGAAAATGTAGGAAGAGTGAGG - Intergenic
1056179354 9:84066794-84066816 CAGATAATGGCAGAAGAGTTGGG + Intergenic
1056227991 9:84515408-84515430 TAGACAATGGAGGCAGAGCCAGG - Intergenic
1057322830 9:94030507-94030529 GAGTGAATGGAGGAAGAGCCAGG - Intergenic
1057945523 9:99324726-99324748 GAGAAGCTAGAGGAAGAGTCAGG + Intergenic
1058378286 9:104350287-104350309 AAGAAAATGGAGAAAGAGTTGGG + Intergenic
1058782750 9:108354748-108354770 CAGAAACTGGATTAAGATTCAGG + Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1060604985 9:124905622-124905644 CAGAAAATGGAATAAGAGGTGGG + Intronic
1060764710 9:126285248-126285270 CAGAAAATGGAAAAACAATCTGG + Intergenic
1061945906 9:133908081-133908103 CAGAGAGTGGAGGGAGGGTCTGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1186015389 X:5185748-5185770 CAGAATATCTAGGAAGGGTCAGG - Intergenic
1187211961 X:17240824-17240846 CAGAAAATAGAGTAAGAATGAGG + Intergenic
1187783308 X:22854519-22854541 CAGAAAATGGACTAAGATACAGG - Intergenic
1189326852 X:40117820-40117842 CAGAAAGAGGAGGAAGCCTCAGG - Intronic
1189357906 X:40325395-40325417 CATAAAAGGGTGTAAGAGTCTGG + Intergenic
1189710528 X:43806961-43806983 GAGAAAATAGAAGATGAGTCTGG - Intronic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190836135 X:54102323-54102345 CAGAAAATAGACTAAGAGGCAGG - Intronic
1190836870 X:54109322-54109344 CAGAAAATAGACTAAGAGGCAGG + Intronic
1190959026 X:55227250-55227272 CAGAAAATTGGGGAGGAGTGGGG + Intronic
1192543047 X:71991242-71991264 AAGAAAATGGGAGAAGAGTGGGG - Intergenic
1192546815 X:72021266-72021288 AAGAAAATAGAGGCAGAGCCAGG - Intergenic
1192901563 X:75503950-75503972 ATGAAAATGGAGACAGAGTCTGG - Intronic
1193722136 X:84999458-84999480 CAGAAAGTGATAGAAGAGTCTGG - Intergenic
1193865748 X:86728011-86728033 CAGAAAAATGAGGAAAAGTTTGG + Intronic
1195292121 X:103439406-103439428 CAGAGAATTAACGAAGAGTCTGG - Intergenic
1195433068 X:104811223-104811245 CAAAAAAACAAGGAAGAGTCAGG + Intronic
1196459356 X:115913821-115913843 CACAAAAAGGAGGAAGAGAAAGG + Intergenic
1197094442 X:122576000-122576022 CAGAAAATTGAGGGAGAGTTTGG - Intergenic
1197255351 X:124257099-124257121 CAGAAAGTGGGGGTAAAGTCAGG + Intronic
1197492781 X:127139281-127139303 CAGAAACTGGAGTACGAGTTGGG + Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1197974685 X:132154120-132154142 CAGGAAATGCAGGAAGCCTCTGG + Intergenic
1198014979 X:132601379-132601401 CAGAAAGTGGAGGATGTCTCAGG - Intergenic
1198157057 X:133971471-133971493 AGGAAAATGGAGGAAGAGAGAGG + Intronic
1198539698 X:137624243-137624265 GAGAAAAGGGAGGAAGAGAGAGG - Intergenic
1198841690 X:140864663-140864685 CAGACAATGGACGAAGAGAGAGG + Intergenic
1199124651 X:144101942-144101964 CAGAAAAAGCCGGTAGAGTCAGG - Intergenic
1199838633 X:151620475-151620497 CTGAAAATGAAGGAAGGCTCGGG + Intronic
1200834335 Y:7718175-7718197 CAGGGAATGGAGAAAAAGTCTGG - Intergenic
1201416884 Y:13755835-13755857 CCAAAAATGGTGTAAGAGTCAGG - Intergenic
1201696006 Y:16827057-16827079 CAGAAATGGGAGGAAGAGGAAGG - Intergenic
1201712989 Y:17012681-17012703 CACAAAATATATGAAGAGTCAGG - Intergenic
1201742945 Y:17343260-17343282 CAGGAAGAGAAGGAAGAGTCTGG + Intergenic