ID: 1099627605

View in Genome Browser
Species Human (GRCh38)
Location 12:85094826-85094848
Sequence TTCTGGTTAGATATATTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 714}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099627605 Original CRISPR TTCTGGTTAGATATATTGCT AGG Intronic
900338074 1:2174600-2174622 TCCGGGTTATAGATATTGCTGGG + Intronic
901250612 1:7776237-7776259 TTTTGGTTAAATTTATTCCTAGG + Intronic
902085593 1:13858486-13858508 CCCTGGTTAGCTATATTTCTAGG + Intergenic
904414493 1:30349255-30349277 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
904695940 1:32331533-32331555 TTCTGGTTAGTCATATTGGAAGG - Exonic
905520109 1:38591157-38591179 TTCTTGTTAAATTTATTCCTAGG + Intergenic
906006810 1:42480237-42480259 TTTTTGTTAGATTTATTCCTAGG + Intronic
906163282 1:43667141-43667163 TTCTGGTTAGATACGTTGGCTGG + Intronic
906451066 1:45948178-45948200 CTCTGGTTAGCTGTATTCCTAGG - Intronic
906600177 1:47119852-47119874 AATTGGTTAGATATATTCCTAGG - Intergenic
906890176 1:49704001-49704023 CTTTGGTTAGATTTATTTCTAGG - Intronic
906893889 1:49749681-49749703 CTCTTGTTAGATTTATTTCTAGG - Intronic
907704585 1:56821321-56821343 TTCTGGCTAGTTACAGTGCTAGG + Intergenic
908283708 1:62570325-62570347 TTCTTGTTAGCTGTATTCCTGGG - Intronic
908867171 1:68562194-68562216 TCTTGGTTAAATATATTCCTAGG + Intergenic
909333494 1:74444455-74444477 TTCTTGTTAGTTGTATTCCTAGG - Intronic
909442652 1:75715070-75715092 CCCTGGTTAGCTATATTTCTAGG - Intergenic
909661211 1:78084654-78084676 TCCTGGTTAGCTGTATTCCTAGG + Intronic
909691654 1:78414085-78414107 CCCTGGTTAGCTGTATTGCTAGG - Intronic
909706719 1:78594206-78594228 TTTTTGTTAGATTTATTCCTAGG - Intergenic
909759907 1:79273390-79273412 TTCTCATGAGATATATTACTGGG - Intergenic
910313260 1:85852696-85852718 TTTTGTTTAGATGTATTGCTAGG + Intronic
910564045 1:88623292-88623314 TTCTGGTTAGCTGTATTCATAGG - Intergenic
910642390 1:89477711-89477733 TTCTTGTTAGCTGTATTCCTAGG - Intergenic
910741502 1:90523913-90523935 TCCTGATTAGCTATATTCCTAGG - Intergenic
911291974 1:96067647-96067669 CTCTGGTTAAATTTATTCCTAGG + Intergenic
911374007 1:97028207-97028229 TCCTTGTTAGATGTATTCCTAGG - Intergenic
911492150 1:98583463-98583485 CCTTGGTTAGATATATTCCTAGG + Intergenic
911649470 1:100371019-100371041 TGTTGGTTAGATGTATTCCTAGG + Intronic
912188433 1:107308847-107308869 CTCTGGTTAGCTGTATTTCTAGG + Intronic
912279686 1:108299977-108299999 CCCTGGTTAGCTATATTCCTGGG + Intergenic
912288540 1:108394380-108394402 CCCTGGTTAGCTATATTCCTGGG - Intronic
913420755 1:118665945-118665967 CTTTGGTTAGATGTATTCCTAGG - Intergenic
914693394 1:150052440-150052462 CCCTGGTTAGCTGTATTGCTAGG - Intergenic
914697666 1:150100256-150100278 TCCTGGTTAGCTGTATTCCTAGG - Intronic
914965605 1:152255034-152255056 TTTTGGTTAAATTTATTCCTAGG + Intergenic
915052430 1:153089610-153089632 CCCTGGTTAGCTATATTCCTAGG - Intergenic
915085186 1:153382556-153382578 TGCTGGTTAGATATTTTCTTAGG - Intergenic
915818465 1:158995574-158995596 TCCTGGTTAGCTGTATTCCTGGG + Intergenic
917047839 1:170882859-170882881 TGCTGGTCAAATATCTTGCTTGG + Intergenic
917572583 1:176283972-176283994 TCCTAGTTAGATGTATTTCTCGG + Intergenic
917658462 1:177152488-177152510 TTCTTGTTAGATTTACTTCTAGG - Intronic
917820955 1:178763564-178763586 CTCTAGTTAGCTATATTCCTAGG + Intronic
918169205 1:181979696-181979718 CTCTTGTTAGCTGTATTGCTAGG - Intergenic
918395095 1:184105847-184105869 TCCTGGTTAGCTGTATTTCTAGG + Intergenic
918677505 1:187305744-187305766 TGCTGGTTAGCTGTATTTCTAGG - Intergenic
918787887 1:188788497-188788519 TCTTGGTTAGATGTATTCCTAGG - Intergenic
918972044 1:191432656-191432678 TTCTGATTTTATATTTTGCTTGG - Intergenic
919594268 1:199542446-199542468 CCTTGGTTAGATATATTCCTAGG - Intergenic
919601486 1:199628388-199628410 TTTTTGTTAGATTTATTTCTTGG - Intergenic
919608304 1:199713688-199713710 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
920611805 1:207447501-207447523 TTCTGATTATATATATTTATAGG + Intergenic
920777842 1:208957799-208957821 TTTTGGTTAAATACACTGCTAGG - Intergenic
921817894 1:219584901-219584923 TTTTGGTTAAATTTATTTCTAGG + Intergenic
921983294 1:221282192-221282214 GACTGGTTAGATGTATTCCTAGG + Intergenic
923345666 1:233049892-233049914 TTTTGGTTAGATGTATTCTTAGG - Intronic
923645424 1:235815708-235815730 TCCTGGTTAGCTGTATTCCTAGG - Intronic
924151181 1:241131566-241131588 TTCTTTTTAGATATATGTCTGGG + Intronic
1063237919 10:4137679-4137701 TTTTGGTTGGATAGATTCCTAGG - Intergenic
1063723156 10:8605390-8605412 TTCTTTTTAGTTATACTGCTTGG - Intergenic
1064525576 10:16253026-16253048 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1064777068 10:18790503-18790525 CCTTGGTTAGATGTATTGCTAGG + Intergenic
1065295631 10:24271831-24271853 TTCTAGCTATATATATTTCTTGG + Intronic
1065418218 10:25512251-25512273 TCTTGGTTAGGTATATTCCTAGG + Intronic
1065461661 10:25973199-25973221 TCCTTGTTAGCTCTATTGCTAGG + Intronic
1065592188 10:27275386-27275408 TTCTGGTTAGCTGTATTCCTAGG - Intergenic
1065658165 10:27974956-27974978 TTCTGATTAGCTCTATTCCTAGG + Intronic
1065681224 10:28234718-28234740 TTCTGGTTAGGTATATTGTAAGG - Intronic
1066685039 10:37973277-37973299 TTTTGGTTAAATTTATTCCTAGG - Intronic
1067515183 10:46934129-46934151 CTCTGGTTAAATTTATTCCTAGG + Intronic
1067647071 10:48117681-48117703 CTCTGGTTAAATTTATTCCTAGG - Intergenic
1067737058 10:48864782-48864804 TCTTGGTTAAATATATTCCTAGG + Intronic
1067827343 10:49586664-49586686 TCTTGGTTAGATTTATTCCTAGG - Intergenic
1068039277 10:51802482-51802504 TTCAGTTTAGATATTTTGATGGG + Intronic
1068262328 10:54598897-54598919 TTCTGGTTAGCTGTATTCCTAGG - Intronic
1068396431 10:56467528-56467550 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1068610096 10:59049834-59049856 CTTTGGTTAGATGTATTCCTAGG + Intergenic
1069194788 10:65537621-65537643 CCCTGGTTAGTTATATTCCTCGG - Intergenic
1070857900 10:79622290-79622312 CCCTGGTTAGCTGTATTGCTGGG - Intergenic
1071022746 10:81078112-81078134 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1071195020 10:83148612-83148634 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1071875997 10:89843851-89843873 CTCTGGTTAAATATATTCCTAGG + Intergenic
1072144865 10:92625850-92625872 CTCTGGTTAGTTGTATTCCTAGG - Intronic
1072831977 10:98668187-98668209 CCTTGGTTAGATATATTCCTAGG - Intronic
1073193425 10:101668633-101668655 TACAGGTTAAAAATATTGCTTGG + Intronic
1073569565 10:104565598-104565620 TCCTGGTTAGATTTATTTGTAGG + Intergenic
1073662058 10:105487210-105487232 ATCTGTTTACATTTATTGCTAGG + Intergenic
1073664345 10:105513237-105513259 ATTTGGTTAGAAAGATTGCTTGG - Intergenic
1074013824 10:109512098-109512120 CCCTGGTTAGATGTATTCCTAGG + Intergenic
1074087063 10:110216197-110216219 TTCTGTTTACATATATTCCCTGG - Intronic
1074746297 10:116536316-116536338 CTTTGGTTAGCTATATTCCTAGG + Intergenic
1074807723 10:117070458-117070480 TTCTGGGCAGTTATTTTGCTGGG - Intronic
1075164657 10:120056261-120056283 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1075179774 10:120199864-120199886 CTCTGGTTAGATGTATTTCCAGG + Intergenic
1076026573 10:127119847-127119869 TTATGGTCAGATATTCTGCTTGG + Intronic
1076085842 10:127630338-127630360 CTTTGGTTATATTTATTGCTGGG + Intergenic
1076933330 10:133549505-133549527 TCCTTGTTAGCTATATTCCTAGG - Intronic
1077832353 11:5887554-5887576 TTCTGGTTAAATATATTGATGGG + Intronic
1077982805 11:7318169-7318191 CTCTTGTTAGATTTATTGCTAGG + Intronic
1078035505 11:7800523-7800545 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1078294686 11:10056459-10056481 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1078302445 11:10145997-10146019 TCCTGGTTAGCTGTATTCCTAGG - Intronic
1078517656 11:12037744-12037766 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1078684273 11:13513266-13513288 TCTTGGTTAGATATATTCCTAGG + Intergenic
1079255414 11:18823957-18823979 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1079474639 11:20816364-20816386 TTTTGGTTAGACTTATTCCTAGG + Intronic
1079636237 11:22744898-22744920 CTCTAGTTAGATGTATTCCTAGG - Intronic
1079920889 11:26433116-26433138 CTCTGGTTAGCTGTATTCCTAGG + Intronic
1080318306 11:30975637-30975659 CTTTGGTTAAATCTATTGCTAGG - Intronic
1080364881 11:31562056-31562078 TTATGAGTAGACATATTGCTGGG + Intronic
1080402476 11:31948868-31948890 TTCTGTTTTGATGTATTTCTAGG - Intronic
1081178182 11:39954630-39954652 GTCTTTTTAGATATTTTGCTGGG - Intergenic
1081698397 11:45135589-45135611 TTCTGTTTAGGTTTATTTCTAGG - Intronic
1082223645 11:49674109-49674131 CTTTGGTTAGATGTATTCCTAGG + Intergenic
1082616075 11:55361260-55361282 CTCTGGTTAGTTGTATTCCTAGG - Intergenic
1082676703 11:56113685-56113707 TCCTGGTTAGCTGTATTTCTAGG - Intergenic
1082873769 11:57967928-57967950 TTTTTGTTAGATTTATTTCTAGG + Intergenic
1082908448 11:58340662-58340684 CCTTGGTTAGATATATTACTAGG + Intergenic
1084841343 11:71852673-71852695 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1085901569 11:80706285-80706307 TCCTGCTTAGCTATATTCCTAGG - Intergenic
1086196830 11:84150275-84150297 TTTTGGTTAGATGGATTCCTAGG + Intronic
1086430750 11:86733976-86733998 TTTTGGTTACATTTATTCCTAGG - Intergenic
1086497094 11:87415556-87415578 TTCTGGGTGGATTTATTTCTGGG - Intergenic
1086569982 11:88271596-88271618 ATCTGGTTAAATTTATTCCTAGG - Intergenic
1086762426 11:90649184-90649206 TTCTTGTTAGCTGTATTTCTAGG - Intergenic
1086773311 11:90796491-90796513 TTCTGCTAAGATATTTTTCTGGG - Intergenic
1086787032 11:90981599-90981621 TTCTTGTTAGCTTTATTCCTAGG + Intergenic
1087488397 11:98789188-98789210 CCTTGGTTAGATATATTCCTGGG - Intergenic
1087513174 11:99124246-99124268 TCCTGGTTAGCTATATTCCTAGG + Intronic
1087817315 11:102673972-102673994 ATCTGGTAAGAACTATTGCTGGG + Intergenic
1088338960 11:108741522-108741544 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1088387103 11:109271350-109271372 TCCTGGTTAGGTTTATTTCTTGG + Intergenic
1088547647 11:110976460-110976482 TTTTGGTTAAATTTATTCCTAGG - Intergenic
1088703600 11:112438620-112438642 TTTTGGTTAAATTTATTCCTAGG + Intergenic
1088952315 11:114584293-114584315 TTCTGGTTAGTCATATTGGAAGG - Intronic
1088998276 11:115024087-115024109 TTCTTTTTTGATCTATTGCTTGG - Intergenic
1090133147 11:124167032-124167054 CCCTGGTTAGCTATATTCCTAGG + Intergenic
1090143417 11:124291305-124291327 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1090677129 11:129009218-129009240 TTCTTATTAGGAATATTGCTAGG + Intronic
1090742564 11:129678412-129678434 CTCTGGTTAGCTGTATTACTAGG - Intergenic
1091078566 11:132644025-132644047 TTCTATTTAAATTTATTGCTTGG + Intronic
1091156605 11:133380461-133380483 TCCTCGTTAGGTATATTACTTGG - Intronic
1092334099 12:7613339-7613361 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1092514017 12:9188800-9188822 CCCTGGTTAGCTATATTTCTAGG - Intronic
1092569367 12:9706092-9706114 TTCTTGTTAGCTGTATTCCTAGG + Intergenic
1093491090 12:19705195-19705217 CTCTGGTTAGCTGTATTCCTAGG - Intronic
1093734360 12:22603754-22603776 ATTTGGTTAGATTTATTCCTAGG - Intergenic
1093793569 12:23284875-23284897 ATTTGGTTAGCTATATTCCTAGG - Intergenic
1094431630 12:30375980-30376002 TCCTTGTTAGCTATATTCCTAGG + Intergenic
1094656616 12:32425792-32425814 TTCTTGTAAGATGTATTCCTAGG + Intronic
1094782311 12:33805104-33805126 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1094811724 12:34144860-34144882 CTCTTGTTAGCTATATTCCTAGG - Intergenic
1095218963 12:39585234-39585256 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1095823942 12:46511806-46511828 TCCTGGTTAGGTGTATTCCTAGG + Intergenic
1095892994 12:47251943-47251965 TTCTGTTTTGATGTATTTCTAGG - Intergenic
1095905655 12:47375134-47375156 CTTTGGTTAGATGTATTCCTAGG - Intergenic
1095908304 12:47400257-47400279 CTTTGGTTAGATGTATTCCTAGG - Intergenic
1096032010 12:48426800-48426822 CCCTGGTTAGTTATATTCCTAGG + Intergenic
1096134822 12:49190884-49190906 TTTTTGTTAAATATATTTCTGGG - Intronic
1096442669 12:51658328-51658350 TCCTGGTTAAATTTATTCCTAGG + Intronic
1098347452 12:69521120-69521142 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1098684875 12:73407048-73407070 CTTTGGTTAGATGTATTCCTAGG - Intergenic
1099394891 12:82125516-82125538 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1099627605 12:85094826-85094848 TTCTGGTTAGATATATTGCTAGG + Intronic
1099646222 12:85360412-85360434 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1099741407 12:86640125-86640147 TTCTTCTTAGATATATTTATGGG - Intronic
1099840387 12:87957234-87957256 TCATGGTTAGATGTATTCCTAGG + Intergenic
1100488459 12:95054726-95054748 ATCTAGTTAGATATGTTGCTAGG - Intronic
1100849356 12:98693141-98693163 CTTTGGTTAGATGTATTCCTGGG + Intronic
1100971345 12:100074270-100074292 TTTTGGTTAGATGTATTCCTAGG - Intronic
1101075476 12:101125185-101125207 TTCTTGTTAGCTGTATTCCTAGG + Intronic
1103179334 12:118895430-118895452 TCCTGGTTAGCTCTATTCCTAGG - Intergenic
1103729201 12:123014961-123014983 CTTTGGTTAAATATATTCCTAGG - Intronic
1104338863 12:127928468-127928490 TTCTGGTTAGATTTTCTGATTGG - Intergenic
1104677686 12:130724999-130725021 TCCTGGTTAGTTGTATTCCTAGG - Intergenic
1105689863 13:22826455-22826477 TCCTGGTTAAATGTATTTCTAGG - Intergenic
1106216235 13:27703112-27703134 TTCTGGTTATTAATTTTGCTTGG + Intergenic
1106409825 13:29503710-29503732 TTTTGGGTAGAAATATTCCTGGG - Exonic
1106753723 13:32799986-32800008 TTTTTCTTAGATTTATTGCTTGG - Intergenic
1107066937 13:36224566-36224588 CCTTGGTTAGATATATTCCTAGG - Intronic
1107269996 13:38604368-38604390 TTCTTCTTAAATATAATGCTCGG - Intergenic
1107324138 13:39222582-39222604 TCCTTGTTAGCTATATTCCTTGG - Intergenic
1107465268 13:40644141-40644163 TGCTGGTTAGATATATTTACTGG - Intronic
1108822578 13:54371695-54371717 CCTTGGTTAGATAAATTGCTAGG - Intergenic
1108865262 13:54915573-54915595 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1108890247 13:55249325-55249347 ATCTGGTTACATTTATTCCTAGG - Intergenic
1109095038 13:58103266-58103288 CCTTGGTTAGATATATTCCTAGG + Intergenic
1110297169 13:73880799-73880821 GTTTGGTTAGTTATACTGCTAGG - Intronic
1110742329 13:79012434-79012456 TCTTGGTTAGATGTATTCCTAGG + Intergenic
1111169673 13:84509251-84509273 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1111232137 13:85357441-85357463 CTCTGGTTAGTTGTATTCCTGGG - Intergenic
1111334739 13:86804667-86804689 TTCTGGTCAGATTTGTTACTAGG + Intergenic
1111350781 13:87027653-87027675 TTCTTTTTAAAAATATTGCTTGG - Intergenic
1111439759 13:88265632-88265654 TCATGGTTAGCTATATTTCTAGG - Intergenic
1111508596 13:89229795-89229817 CTTTGGTTATATATATTTCTAGG + Intergenic
1111693705 13:91596380-91596402 ATGTGGTTAAATATATTGTTAGG + Intronic
1111791121 13:92856754-92856776 TCTTGGTTAGATGTATTCCTAGG - Intronic
1111817852 13:93176660-93176682 TTCTGGTTAGCTGTATTCCTAGG - Intergenic
1112140920 13:96641234-96641256 CTTTGGTTAGATGTATTCCTAGG + Intronic
1112421247 13:99251106-99251128 TCGTGGTTAGATGTATTCCTAGG + Intronic
1112614837 13:100993400-100993422 CTTTGGTTAGATATATTTCCAGG - Intergenic
1113211451 13:107986870-107986892 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1113379512 13:109788683-109788705 TCCTGACTAGACATATTGCTAGG - Intergenic
1115005222 14:28474474-28474496 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1115020112 14:28669323-28669345 TTCTGCTTGAATAAATTGCTAGG - Intergenic
1115680493 14:35732256-35732278 TTCTGTTTTGATATGTTTCTAGG - Intronic
1116126048 14:40785899-40785921 ACTTGGTTAGATATATTCCTAGG + Intergenic
1116592528 14:46796630-46796652 TTCTGGTTAGCTGTATTCCCAGG + Intergenic
1116637780 14:47418759-47418781 TACCAGTTAGATATAATGCTTGG - Intronic
1116743432 14:48785721-48785743 TTCTTGTTCGATAGAGTGCTTGG - Intergenic
1116753617 14:48918125-48918147 TTTTGGTTAAGTATATTCCTAGG - Intergenic
1117160902 14:52988572-52988594 TTCTAGGCAGATATATTGGTAGG + Intergenic
1117360677 14:54970434-54970456 CCTTGGTTAGATATATTCCTAGG - Intronic
1117824975 14:59692336-59692358 TTTTGGTTAGATGTGTTCCTAGG - Intronic
1117917708 14:60695266-60695288 TTTTGGTTAAATTTATTCCTAGG + Intergenic
1118081318 14:62364394-62364416 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1118527942 14:66667060-66667082 TTGTTGTTAGCTATATTCCTAGG - Intronic
1120064424 14:80023767-80023789 TCCTGGTTAGTTGTATTCCTAGG + Intergenic
1120199441 14:81520346-81520368 TTCTTGGTATATATTTTGCTAGG - Intronic
1120571198 14:86118479-86118501 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1121706310 14:95997547-95997569 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1122259698 14:100507621-100507643 TCTTGGTTAGATGTATTCCTAGG + Intronic
1122620035 14:103051050-103051072 TTTTGGTTAGTTTTATTGATTGG - Intronic
1123453679 15:20394480-20394502 TCCTGGTTAGCTGTATTCCTGGG + Intergenic
1124156519 15:27230113-27230135 CCCTGGTTAGCTATATTCCTAGG + Intronic
1125089992 15:35779142-35779164 AACTGGTTAAATATATTGCTTGG + Intergenic
1125126261 15:36225529-36225551 TCTTGGTTAGATGTATTGCTAGG - Intergenic
1125292624 15:38166555-38166577 TCTTGGTTAGATGTATTCCTTGG + Intergenic
1126202296 15:46000386-46000408 TCTTGGTTAGATATACTCCTAGG + Intergenic
1126227304 15:46285856-46285878 CCCTGGTTAGCTATATTCCTAGG + Intergenic
1126880260 15:53087058-53087080 ACCTGGTTTGATATATTCCTAGG + Intergenic
1126949028 15:53858965-53858987 TTGTGTTTAGATATATTTATGGG + Intergenic
1126968161 15:54079526-54079548 TCTTGGTTAGATGTATTCCTGGG + Intronic
1127190258 15:56522681-56522703 CCTTGGTTAGATATATTCCTAGG - Intergenic
1130733623 15:86525170-86525192 TCCTTGTTAAATATATTCCTGGG - Intronic
1131626930 15:94130406-94130428 TCTTGGTTAAATATATTCCTAGG + Intergenic
1133001004 16:2851719-2851741 TTCTGGTTGGAGATATTTCATGG + Intergenic
1134501708 16:14774031-14774053 ATCTTGTTATATATATTTCTTGG + Intronic
1134578856 16:15354847-15354869 ATCTTGTTATATATATTTCTTGG - Intergenic
1134723731 16:16402703-16402725 ATCTTGTTATATATATTTCTTGG + Intergenic
1134943698 16:18309167-18309189 ATCTTGTTATATATATTTCTTGG - Intergenic
1135519672 16:23165384-23165406 TTCTTGTCAGATTTATTTCTAGG - Intergenic
1135654979 16:24240110-24240132 TTCTAGTTACATTTATTTCTAGG - Intergenic
1137302797 16:47169410-47169432 TTTTGGTTAAATATATTCCTAGG + Intronic
1140163443 16:72524085-72524107 TTTTGGTTAAATTTATTCCTAGG - Intergenic
1140614219 16:76640781-76640803 TTTTGGTTATATTTATTCCTAGG + Intergenic
1140636736 16:76923760-76923782 TTCTGGTTAGCTGTATTCCTAGG + Intergenic
1142879201 17:2871319-2871341 CTCTGGTTAGATACATTCCAGGG + Intronic
1143257391 17:5571521-5571543 TCCTGGTTAGATGTATTCCTAGG - Intronic
1144155946 17:12502747-12502769 TCCTGGTTATGTATATTCCTAGG - Intergenic
1144616236 17:16776419-16776441 TTCTTGTTAGCTGTATTCCTAGG + Intronic
1144896468 17:18539241-18539263 TTCTTGTTAGCTGTATTCCTAGG - Intergenic
1145135750 17:20404980-20405002 TTCTTGTTAGCTGTATTCCTAGG + Intergenic
1149364548 17:55929479-55929501 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1149461849 17:56834768-56834790 TTCTGGTTAGGTATCGTCCTTGG + Exonic
1149940593 17:60861209-60861231 TTCTGGTTAGCAGTATTCCTAGG + Intronic
1150533398 17:66010177-66010199 CTCTGGTTAGGTGTATTCCTAGG + Intronic
1150539203 17:66078744-66078766 TTCTGTTTTGATATGTTTCTAGG + Intronic
1153248942 18:3101014-3101036 CTTTGGTAAGCTATATTGCTAGG + Intronic
1153876646 18:9378540-9378562 CACTGGTTAGGTATATTCCTAGG - Intronic
1155499756 18:26475469-26475491 TTCTCGTTAGGTTTATTCCTAGG + Intronic
1155708969 18:28851979-28852001 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1155863756 18:30938265-30938287 TTCAAATGAGATATATTGCTGGG - Intergenic
1155900716 18:31386523-31386545 CTCTGGATAGATAGATAGCTTGG - Intronic
1156087084 18:33418763-33418785 TCCTGGTTAGCTGTATTCCTAGG - Intronic
1156931705 18:42652510-42652532 CACTGGTTAGCTATATTCCTTGG - Intergenic
1156934346 18:42684671-42684693 TCTTGGTTAAATATATTCCTAGG - Intergenic
1156965717 18:43089349-43089371 TTCTGGTTAGCTGTATTCCTAGG - Intronic
1157018444 18:43748109-43748131 TTCTGTTTATATCTATTACTAGG - Intergenic
1157417470 18:47517224-47517246 TTTTGGTTAAATTTATTCCTGGG - Intergenic
1158037440 18:53050492-53050514 TCCTGGTTAGGTGTATTCCTAGG + Intronic
1158296762 18:56005873-56005895 TTCTCATTAGATTTATTTCTAGG + Intergenic
1158330132 18:56353072-56353094 TTCTGGATAGAAATATTGTGGGG + Intergenic
1158577558 18:58651810-58651832 TCCTGGTTAAATATATTCCCAGG + Intergenic
1158656700 18:59343072-59343094 TCTTGGTTAAATATATTTCTAGG - Intronic
1158961412 18:62590904-62590926 TTCTTGTTAGATGCATTGCTGGG + Intergenic
1159395547 18:67850927-67850949 CTCTGGTTAGATGCATTCCTAGG - Intergenic
1160271539 18:77389599-77389621 TTTTGGTTAAATTTATTCCTTGG + Intergenic
1163950253 19:20577230-20577252 TTCTGCTTTCATATTTTGCTTGG + Intronic
1163967744 19:20764178-20764200 TTCTGCTTTTATATTTTGCTTGG - Intronic
1164493186 19:28733064-28733086 TCTTGGTTAGATATATTACTAGG + Intergenic
1164496632 19:28770409-28770431 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1165972748 19:39646504-39646526 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1166908026 19:46128043-46128065 CCCTGGTTAGCTATATTCCTAGG + Intergenic
1167535070 19:50044801-50044823 ACCTGGTTAGATAGTTTGCTAGG + Exonic
1167670824 19:50852287-50852309 CTTTGGTTAGATAAAGTGCTGGG + Intergenic
1167817919 19:51900385-51900407 GGATGCTTAGATATATTGCTTGG - Intronic
1168367607 19:55802440-55802462 CTCTGGTTAGCTGTATTCCTAGG - Intronic
925145167 2:1577670-1577692 TTTTTGTTAGATTTATTTCTTGG - Intergenic
925453717 2:3995223-3995245 CTCTTGTTAGATGTATTTCTAGG + Intergenic
925553718 2:5105282-5105304 CCCTGGTTAGCTATATTGCTAGG + Intergenic
926481617 2:13404758-13404780 TCCTGGTTAGCTGTATTCCTGGG - Intergenic
926538396 2:14143396-14143418 TCCTGGTTAGCTGTATTTCTAGG + Intergenic
928470532 2:31570799-31570821 CTCTGGTTAGTTGTATTCCTAGG - Intronic
928533597 2:32217780-32217802 CTTTGGTTAGATGTATTTCTAGG + Intronic
928679921 2:33691341-33691363 CTCTGGTTAGCTGTATTTCTAGG + Intergenic
930211175 2:48638975-48638997 CCCTGGTTAGCTGTATTGCTAGG - Intronic
930592287 2:53342222-53342244 TACTGGTTAGTTGTATTCCTAGG + Intergenic
930677150 2:54214968-54214990 TCCTAGTTAGCTATATTACTAGG + Intronic
930995055 2:57706863-57706885 TTCTGGTGAGTTATTTAGCTTGG + Intergenic
931779969 2:65570980-65571002 CTCTGGTTAGCTATATTCCTAGG + Intergenic
931889592 2:66656574-66656596 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
931929748 2:67118125-67118147 CCCTGGTTAGCTATATTCCTAGG - Intergenic
932534666 2:72580483-72580505 TTATGTATAGAAATATTGCTGGG - Intronic
933473672 2:82761636-82761658 TTCTGGTTAGACATTATTCTGGG + Intergenic
933593199 2:84256071-84256093 TCCTGGTTAGCTATATTCCTAGG + Intergenic
934769160 2:96896871-96896893 TTCTGTTTAGATAGATAGATAGG - Intronic
935063589 2:99629432-99629454 CCCTGGTTAGCTATATTCCTAGG - Intronic
935440585 2:103090729-103090751 CCCTGGTTAGCTATATTTCTAGG + Intergenic
935803097 2:106718310-106718332 TCCTGGTTAGATGTATTTCTAGG + Intergenic
935932383 2:108141849-108141871 GCCTGGTTAGATATATTCCAAGG - Intergenic
936101271 2:109582131-109582153 CCTTGGTTAGATATATTCCTAGG - Intronic
936150138 2:110013254-110013276 CCTTGGTTAGATATATTCCTAGG + Intergenic
936194536 2:110358116-110358138 CCTTGGTTAGATATATTCCTAGG - Intergenic
936274912 2:111087076-111087098 TTCTGGTTATTTGTATTTCTAGG - Intronic
936857228 2:116973622-116973644 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
936894828 2:117415485-117415507 TTCTTGTTAGGTATATTCCTAGG + Intergenic
937020889 2:118653796-118653818 TCTTGGTTAAATTTATTGCTAGG - Intergenic
937058047 2:118955989-118956011 TTCTGTTTTGATGTATTTCTGGG - Intronic
937396353 2:121538947-121538969 TTTTGGCTAGATTTATTCCTAGG - Intronic
937464399 2:122118396-122118418 TTCTGGTTAGATTTTTCCCTAGG + Intergenic
938867341 2:135436536-135436558 CCCTGGTTAGATAGATTCCTAGG - Intronic
938933437 2:136107619-136107641 TACTGGTTTGCCATATTGCTTGG - Intergenic
939274650 2:139985463-139985485 CCCTGGTTAGCTGTATTGCTAGG + Intergenic
939342972 2:140924773-140924795 TTATGGTTAGATAAAATACTTGG + Intronic
939503809 2:143018845-143018867 TCTTGGTTAGATGTATTCCTAGG + Intronic
939789492 2:146553958-146553980 TTGTGGTTAGAAATATTCCGAGG - Intergenic
940203486 2:151176703-151176725 TTCTGGCTATAAATAATGCTAGG - Intergenic
940258541 2:151757617-151757639 TTCAGGTGAGAAATATTGATTGG - Intergenic
940488987 2:154332620-154332642 TTCTGGAGAGATTTGTTGCTGGG - Intronic
940628791 2:156211162-156211184 TTCTGATTAGCTATATTCCTAGG + Intergenic
940653272 2:156458358-156458380 TTCTGGTTTGATTTGTTGTTGGG + Intronic
940708277 2:157131057-157131079 CCCTGGTTAGCTATATTCCTAGG - Intergenic
940896852 2:159089305-159089327 TTGTAGTTAGATATTTTACTAGG + Intronic
941057945 2:160809752-160809774 TTCTTGTTAGCTATATTCCTGGG + Intergenic
941587219 2:167375557-167375579 CCTTGGTTAGATATATTCCTAGG + Intergenic
941708201 2:168682369-168682391 TTTTGGGTAAATATATTGCCAGG + Intronic
941976510 2:171411068-171411090 TTCTGGCTAGGTTTATTCCTAGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942175228 2:173326970-173326992 GTCTGGTGAGATTTATTGCAGGG + Intergenic
942729097 2:179044079-179044101 TTCTTGTTAGTTGTATTCCTAGG - Intronic
942759200 2:179378325-179378347 CCCTGGCTAGATATATTCCTAGG - Intergenic
942914237 2:181283925-181283947 CTTTGGTTAGATGTATTCCTAGG + Intergenic
943102228 2:183501021-183501043 ATTTGGTTAAATATATTCCTAGG + Intergenic
943188873 2:184650726-184650748 CTCTGGTTACATGTATTCCTAGG - Intronic
943220070 2:185092744-185092766 TTTTGGTTAAATTTATTCCTAGG - Intergenic
943229215 2:185224545-185224567 TTTTAGCTAGATATATTGCTAGG + Intergenic
943316217 2:186391209-186391231 CCCTGGTTAGATATATTCCTAGG - Intergenic
943323148 2:186470958-186470980 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
943611599 2:190041236-190041258 TTCTGGTTAGCTGTATTCCTAGG + Intronic
943912540 2:193586827-193586849 TCTTGGTTAAATATATTCCTAGG + Intergenic
943912601 2:193587620-193587642 TCTTGGTTAAATATATTCCTAGG - Intergenic
943923914 2:193746006-193746028 TCCTGGTTAGCTCTATTTCTAGG - Intergenic
944178160 2:196856965-196856987 CCCTGGTTAGCTATATTCCTAGG + Intronic
944519503 2:200550126-200550148 TTTTGGTTAGATTGATTCCTAGG - Intronic
944923812 2:204442337-204442359 TTCCTGTTAAATGTATTGCTAGG - Intergenic
945323380 2:208453926-208453948 TTCTGTTTATATATAATGATCGG - Intronic
945356908 2:208851334-208851356 CTCTGGTTAGCTATATTCTTAGG + Intronic
945363552 2:208922920-208922942 CTTTGGTTAGATTTATTTCTAGG + Intergenic
945366656 2:208963043-208963065 CCCTGGTTAGCTATATTCCTAGG - Intergenic
946103361 2:217347229-217347251 CCCTGGTTAGCTATATTCCTAGG + Intronic
946515654 2:220408257-220408279 TCCTGGTTAGTTGTATTCCTAGG + Intergenic
947327847 2:228997521-228997543 TTCTCTTGAGATATATTGCTTGG + Intronic
947547487 2:231020685-231020707 TTCTGGTGAGATACCTTCCTTGG + Intronic
947699641 2:232221838-232221860 TTCTGCTTGGATACATTTCTGGG + Intronic
948556977 2:238818992-238819014 TTTTGGTCAGATGTATTCCTAGG - Intergenic
1169678224 20:8179351-8179373 CTCTGGTTAGCTGTATTCCTAGG + Intronic
1170300361 20:14877172-14877194 TTTTGGTTAGCTATTTTCCTAGG + Intronic
1170378318 20:15727656-15727678 CTCTGGTTAGCTGTATTCCTAGG + Intronic
1170409336 20:16071739-16071761 CCTTGGTTAGATATATTCCTAGG + Intergenic
1171081505 20:22190514-22190536 CCCTGTTTAGATATATTCCTAGG - Intergenic
1171200561 20:23237925-23237947 TTCTTGTTAGCTGTATTCCTCGG + Intergenic
1171231206 20:23487481-23487503 GTCTGGTTAGCTATATTCCTAGG + Intergenic
1171286215 20:23940070-23940092 TTCTGCTTAAATATATTCCTAGG - Intergenic
1171507575 20:25651034-25651056 CTCTGGTTAAATTTATTCCTGGG + Intergenic
1173307879 20:41867943-41867965 CTCTGGTTAGCTGTATTTCTAGG - Intergenic
1173709611 20:45143147-45143169 TTCTGGTTAGTTGTATTCCTAGG + Intergenic
1176349343 21:5779234-5779256 CTCTTGTTAGATACATTCCTTGG - Intergenic
1176356157 21:5899818-5899840 CTCTTGTTAGATACATTCCTTGG - Intergenic
1176543664 21:8177304-8177326 CTCTTGTTAGATACATTCCTTGG - Intergenic
1176562615 21:8360349-8360371 CTCTTGTTAGATACATTCCTTGG - Intergenic
1177110284 21:17019185-17019207 TGCTGGTCAGATACATTGTTGGG - Intergenic
1177113375 21:17056018-17056040 TCTTGGTTAGATGTATTCCTAGG + Intergenic
1177272354 21:18866040-18866062 ACCTGGTTAGCTATATTCCTAGG + Intergenic
1177603785 21:23352681-23352703 TTGTGCTTAGATATGGTGCTGGG + Intergenic
1178046603 21:28701604-28701626 CCCTGGTTAGCTATATTTCTAGG - Intergenic
1179031322 21:37722220-37722242 CCTTGGTTAGATATATTCCTAGG - Intronic
1180582613 22:16855116-16855138 CCTTGGTTAGATATATTCCTAGG - Intergenic
1181140173 22:20798670-20798692 TTCCTGATAGATGTATTGCTGGG + Exonic
1183757534 22:39783201-39783223 TTTTGGTTAAATTTATTCCTAGG - Intronic
1203248532 22_KI270733v1_random:93526-93548 CTCTTGTTAGATACATTCCTTGG - Intergenic
950848567 3:16039611-16039633 CCCTGGTTAGCTATATTCCTAGG + Intergenic
951233498 3:20207410-20207432 TTCTGCTTAGCTGTATTCCTAGG + Intergenic
951334410 3:21404292-21404314 CTCTGGTTAAACATATTCCTAGG - Intergenic
951856031 3:27198056-27198078 TACTGGTTAGCTGTATTCCTAGG - Intronic
952461297 3:33529096-33529118 CTCTGGTTAGCTATATTCCTAGG - Intronic
952683896 3:36128331-36128353 TTTTGTTTAAATATATTCCTAGG - Intergenic
952708413 3:36404077-36404099 TTCTTGTTAGAGATATTCATAGG - Intronic
953261521 3:41343773-41343795 CTCTTGTTAGCTCTATTGCTGGG - Intronic
954480164 3:50792178-50792200 CTCTGGTTAGCTATATTTCTAGG + Intronic
954521751 3:51233715-51233737 CTTTGGTTAGATGTATTCCTAGG + Intronic
955845483 3:63158526-63158548 TTCTGGTTAATTACATTCCTGGG + Intergenic
956372270 3:68575866-68575888 CCCTGGTTAGCTATATTCCTAGG - Intergenic
957369607 3:79275899-79275921 CTCTGGTTAGGTTTATTCCTAGG - Intronic
957700799 3:83708404-83708426 TCCTTGTTAGCTATATTCCTAGG - Intergenic
957973143 3:87408395-87408417 TTCTTGTTAGTTGTATTCCTAGG - Intergenic
957992217 3:87640708-87640730 CCTTGGTTAGATATATTCCTAGG + Intergenic
958063899 3:88518479-88518501 TACTGGTTAGCTGTATTCCTAGG + Intergenic
958089356 3:88856524-88856546 CCTTGGTTAGATATATTGCTAGG + Intergenic
958445725 3:94212310-94212332 TCTTGGTTAGATGTATTCCTAGG - Intergenic
958626866 3:96637388-96637410 CTCTGGTTAGCTATATTCCTAGG - Intergenic
959439032 3:106353988-106354010 TTCTGGTTGGTTATACTTCTAGG + Intergenic
959679630 3:109079890-109079912 TTCTTGTTAGGTATATTTTTGGG - Intronic
960017147 3:112904246-112904268 TCCTTGTTAGCTATATTCCTAGG + Intergenic
960683777 3:120276381-120276403 TTTTGGTTTGCTATATTCCTAGG + Intronic
960686041 3:120294761-120294783 CTCTGGTTAGCCATATTCCTAGG - Intergenic
961227696 3:125267989-125268011 TCTTGGTTAGATGTATTCCTAGG - Intronic
961342023 3:126231410-126231432 TCCTGGTTAACTATATTCCTAGG + Intergenic
961558905 3:127715366-127715388 GTCTTGTTAGAAATATGGCTTGG - Intronic
961909478 3:130300293-130300315 TTCTGGTGAACTATATTGCATGG - Intergenic
962039442 3:131689963-131689985 CTTTGGTTAGATGTATTCCTAGG - Intronic
962188757 3:133288357-133288379 TTCTGGGTAGAAATATTCTTTGG - Intronic
962335240 3:134524104-134524126 CCCTGGTTAGCTATATTCCTGGG + Intronic
962451600 3:135522788-135522810 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
962478198 3:135775810-135775832 CCCTGGTTAGCTATATTTCTAGG - Intergenic
962651446 3:137497856-137497878 TTTTGGTTAAGTATATTCCTAGG + Intergenic
962861076 3:139402341-139402363 CCCTGGTTAGCTATATTCCTAGG + Intergenic
962907272 3:139815719-139815741 ATCTTGTTAGATGTATTCCTAGG + Intergenic
962997130 3:140641453-140641475 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
963185773 3:142414914-142414936 TTCTGGTTCAATCTATTGATTGG - Intronic
963831035 3:150009589-150009611 CTCTGGTTAGCTGTATTCCTAGG - Intronic
963882497 3:150544895-150544917 TTCAGGTTATATAAACTGCTTGG + Intronic
964443249 3:156733813-156733835 TCTTGGTTAGATATATTCCTAGG - Intergenic
964554827 3:157925537-157925559 TCCTGGTTAGCTGTATTCCTGGG + Intergenic
964928412 3:161984805-161984827 TTCTGGTGAATTATAATGCTGGG - Intergenic
965123259 3:164591086-164591108 CCCTGGTTAGCTATATTCCTGGG + Intergenic
965154201 3:165025860-165025882 TTCTGTTTTGATGTATTTCTAGG - Intronic
965159645 3:165115867-165115889 TTCTTGTTAGCTGTATTCCTAGG + Intergenic
965229723 3:166034814-166034836 CACTGGTTAGCTATATTCCTAGG + Intergenic
965295987 3:166947172-166947194 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
965636168 3:170783267-170783289 TCCTGGTTAGTTGTATTCCTAGG - Intronic
965871695 3:173272891-173272913 TGTTGGTTAAATATATTCCTAGG + Intergenic
965899972 3:173627539-173627561 TTCTGGGTAGATATATCCATGGG - Intronic
965939764 3:174165044-174165066 CTTTGGTTAGATGTATTCCTAGG + Intronic
966124151 3:176555950-176555972 CTCTGAGTAAATATATTGCTTGG - Intergenic
966469431 3:180272124-180272146 CTTTGGTTAGATGTATTCCTAGG + Intergenic
966541230 3:181092198-181092220 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
967401024 3:189060717-189060739 TTCTGGTTAGCTGTATTCCTAGG - Intronic
967978682 3:195051355-195051377 CTCTGGTTGGCTATATTCCTAGG + Intergenic
969782437 4:9418713-9418735 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
970113109 4:12660941-12660963 TACTGGGTAGATATATACCTAGG + Intergenic
970210038 4:13700088-13700110 CCCTGGTTAGCTGTATTGCTAGG + Intergenic
970266120 4:14288391-14288413 CTTTGGTTAGATATATTTCTAGG + Intergenic
970310108 4:14773537-14773559 TCTTGGTTAAATATATTCCTAGG - Intergenic
970346371 4:15156408-15156430 TCTTTGTTAGATATATTCCTAGG + Intergenic
970379946 4:15496836-15496858 TCCTGGTTAGCTGTATTTCTAGG - Intronic
970773476 4:19643647-19643669 TTTTGTTTACATATATTCCTGGG + Intergenic
971429325 4:26547962-26547984 TTCTGGTTAGCTGTATTCCTAGG + Intergenic
971592762 4:28489710-28489732 TTCTGGTGAAATACATTGTTAGG - Intergenic
971602756 4:28616325-28616347 TTCTGGTTAGCTGTATTACTAGG + Intergenic
971614373 4:28768410-28768432 TTCTTGTTAGACGTATTCCTAGG - Intergenic
971685931 4:29768097-29768119 TTCAGTTTAGTTATATTGTTTGG + Intergenic
971952532 4:33372524-33372546 TCCTTGTTAGCTATATTCCTAGG - Intergenic
972078973 4:35125400-35125422 CCCTGGTTAGCTATATTTCTAGG + Intergenic
972143261 4:35988115-35988137 TTCTGGTTAGCTGTATTCCTAGG - Intronic
972188301 4:36559498-36559520 CTCTGTTTAGCTATATTCCTAGG - Intergenic
973034284 4:45386502-45386524 TCCTGGTTTGCTGTATTGCTAGG + Intergenic
973068218 4:45823792-45823814 TTCTGGTTAGATTTATTAACGGG - Intergenic
973151496 4:46893937-46893959 TCCTGGTTAGTTGTATTCCTAGG - Intronic
973180257 4:47258335-47258357 TTGTGGTTTGTTATATTGTTGGG - Intronic
973708953 4:53607384-53607406 CCCTGGTTAGCTATATTCCTAGG - Intronic
974508005 4:62802043-62802065 TTTTGGTTAAATGTATTCCTAGG + Intergenic
974531858 4:63118313-63118335 CTTTGGTTAGATGTATTCCTAGG + Intergenic
975158684 4:71100867-71100889 CCCTGGTTAGTTATATTCCTAGG - Intergenic
975755714 4:77569548-77569570 TCCTGGTTAGCTGTATTCCTAGG - Intronic
975898810 4:79125461-79125483 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
975941914 4:79658191-79658213 CTTTGGTTAGATGTATTCCTAGG - Intergenic
976079520 4:81339699-81339721 TCTTGGTTAAATGTATTGCTTGG + Intergenic
976105152 4:81609013-81609035 TCTTGGTTAGATGTATTCCTAGG - Intronic
976338937 4:83923576-83923598 TTTTTGTTAGAGATCTTGCTAGG - Intergenic
976374894 4:84334767-84334789 TCCTGGTTAGCTGTATTCCTGGG + Intergenic
976481408 4:85550767-85550789 CCCTGGTTAGATGTATTCCTAGG + Intronic
977015508 4:91687984-91688006 TTTTGGTTAGATTTATGCCTAGG + Intergenic
977186755 4:93948401-93948423 CTCTTGTTAGATGTATTCCTTGG - Intergenic
977519275 4:98060340-98060362 TCCTGGTTAGCTGTATTCCTAGG - Intronic
977826436 4:101537769-101537791 TTTTGGTTAGGTATATTCCTAGG - Intronic
977926856 4:102710431-102710453 TTTTGGTTACATTTATTCCTAGG - Intronic
978054367 4:104245183-104245205 CCCTGGTTAGCTATATTCCTAGG + Intergenic
978422714 4:108550818-108550840 CTTTGGTTAAATATATTCCTAGG - Intergenic
978633014 4:110768888-110768910 TCCTTGTTAGACATGTTGCTGGG - Intergenic
978674885 4:111300818-111300840 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
978683371 4:111410509-111410531 CTCTGGTTAGCTGTATTTCTAGG + Intergenic
978940558 4:114431215-114431237 CTCTGGTTAGCTGTATTTCTAGG + Intergenic
979045405 4:115856605-115856627 TCCTGGTTAGCTTTATTCCTAGG - Intergenic
979364324 4:119802564-119802586 TTCTGTTTAGATAGATTGGATGG - Intergenic
979370351 4:119878591-119878613 CTCTGGTTAGATGTATTCCTAGG - Intergenic
979591633 4:122487636-122487658 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
980095474 4:128485717-128485739 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
980258430 4:130414169-130414191 CACTGGTTAGATATATTCCTAGG - Intergenic
980664153 4:135906678-135906700 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
980665644 4:135930197-135930219 CTCTTGTTAGTTATATTCCTAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981275599 4:142895179-142895201 TTTTGGTTAGCTGTATTCCTAGG + Intergenic
981287832 4:143040858-143040880 TTCTGGTTAAATATACTCCTAGG - Intergenic
982050321 4:151494899-151494921 TCCTGGTTAGCTGTATTCCTAGG + Intronic
982354542 4:154451727-154451749 TTCTGGTTGTTTATTTTGCTTGG + Intronic
982505452 4:156211536-156211558 CTCTGGATAGATGTATTCCTAGG - Intergenic
983441640 4:167793847-167793869 TCCTGGTTAGTTGTATTCCTAGG + Intergenic
983824287 4:172238318-172238340 CTCTGGTTAGCTTTATTCCTAGG + Intronic
984135808 4:175936652-175936674 TTCTGGTTTGATATCTTGTTAGG - Intronic
986296369 5:6442595-6442617 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
986906849 5:12504887-12504909 TCCTTGTTAGCTATATTCCTAGG + Intergenic
987270047 5:16298106-16298128 CCCTGGTTAGCTATATTCCTAGG - Intergenic
987611803 5:20214112-20214134 TTCTTGATAGCTATATTTCTAGG - Intronic
987896961 5:23959206-23959228 TTCTTGTTAGCTGTATTCCTAGG - Intronic
987974497 5:24995408-24995430 TTCTGGTTAGCTATATTCCTAGG - Intergenic
988043669 5:25919955-25919977 CTCTGGTTAGTTATATTTCTAGG - Intergenic
988192643 5:27959516-27959538 TTCTGGTTAACTGTATTCCTAGG + Intergenic
988290635 5:29280539-29280561 TTCTGGAAAGATACATAGCTTGG - Intergenic
988966851 5:36427604-36427626 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
988998180 5:36734367-36734389 TTCTATATAGAGATATTGCTGGG + Intergenic
989041619 5:37235256-37235278 TCTTGGTTAAATATATTGCTAGG - Intronic
989127113 5:38065793-38065815 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
989237752 5:39169283-39169305 TTGTGATTATATATATGGCTTGG - Intronic
989299013 5:39866419-39866441 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
989461574 5:41705511-41705533 TCCCGGTTAGCTATATTCCTTGG + Intergenic
989461583 5:41705629-41705651 TCCTGGTTAGCTATATTCCTTGG + Intergenic
989698909 5:44238169-44238191 TTCGGGTTATATATATTTATTGG - Intergenic
989759864 5:45000499-45000521 TTCTGTTTACATACATTGTTTGG - Intergenic
991059183 5:62354123-62354145 TTCAGGTTGGATATAATACTAGG - Intronic
991147966 5:63329526-63329548 TCTTGTTTAGATATATTCCTAGG + Intergenic
991233399 5:64363804-64363826 TCCTGGTTAGCTGTATTCCTGGG + Intronic
991238148 5:64423266-64423288 CTCTGGTTAGCTGTATTTCTAGG - Intergenic
991407626 5:66317180-66317202 ATTTGGTTAGATGTATTCCTAGG + Intergenic
992345674 5:75874830-75874852 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
992499108 5:77324202-77324224 TTCTTATTAGATCTATTGCTGGG + Intronic
992612759 5:78521642-78521664 TTCTGATAAGATAAATTACTTGG + Intronic
993019046 5:82568738-82568760 TCCTGGTTAGCTGTATTTCTTGG - Intergenic
993288417 5:86032255-86032277 CTCTGGGAACATATATTGCTGGG - Intergenic
993404653 5:87496266-87496288 CTTTGGTTAAATATATTGTTAGG - Intergenic
993689316 5:90979546-90979568 TTCTGGTTAGCTATAGAACTGGG - Intronic
993779371 5:92046912-92046934 CTTTGGTTAGATGTATTTCTAGG + Intergenic
993802435 5:92358854-92358876 CTTTGGTTAGATGTATTCCTAGG - Intergenic
993818371 5:92581776-92581798 TTCTGGTTAGCTATCCTCCTAGG - Intergenic
994422977 5:99545464-99545486 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
994567532 5:101470078-101470100 TCCTGGTTAGCTATATTTCTAGG + Intergenic
994832546 5:104804390-104804412 CTTTGGTTAAATATATTCCTAGG - Intergenic
994951441 5:106468663-106468685 CTTTGTTTAAATATATTGCTAGG - Intergenic
995099837 5:108286565-108286587 CTCTGGTTAGCTGTATTCCTTGG - Intronic
996076481 5:119200785-119200807 TCCTGGTTAGCTGTATTCCTAGG + Intronic
996693837 5:126370818-126370840 TTCAGGTTGCATATTTTGCTGGG - Intronic
997344320 5:133175377-133175399 TTTTGGTTAGATTTATTTTTTGG + Intergenic
999346645 5:150828225-150828247 TCTTGGTTAGATGTATTCCTAGG - Intergenic
999939010 5:156520289-156520311 TTCTTGTTAGCTGTATTCCTAGG - Intronic
1000142316 5:158417405-158417427 TTCTGGTTGGACATCTTGGTGGG + Intergenic
1001886636 5:175297502-175297524 TTCTGGTTAGCTGTATTCTTAGG - Intergenic
1002258217 5:177975488-177975510 TCCTGGTTAGCTGTATTTCTAGG - Intergenic
1003686364 6:8307292-8307314 TTTTGGTTAGATTTATTCCTAGG + Intergenic
1004068038 6:12269049-12269071 CCCTGGTTAAATTTATTGCTGGG + Intergenic
1004574253 6:16878426-16878448 CCCTGGTTAGATGTATTCCTAGG + Intergenic
1004599774 6:17137297-17137319 CTTTGGTTAGATGTATTCCTAGG - Intergenic
1004614145 6:17273800-17273822 TTCTTGTTAGTTGTATTCCTAGG - Intergenic
1004750057 6:18553428-18553450 TTCTGGTTAGACATATAATTTGG - Intergenic
1004825867 6:19420540-19420562 CTCTGGTTAGCTATATTCCTAGG + Intergenic
1004872191 6:19917675-19917697 CTTTGGTTAGATATATTCCTAGG - Intergenic
1005702058 6:28411986-28412008 GCTTGGTTAGATATATTCCTAGG + Intergenic
1007034963 6:38664922-38664944 ATCTTGTTAGATTTATTCCTAGG + Intergenic
1007049263 6:38809683-38809705 TTTTTGTTAGATTTATTCCTTGG + Intronic
1007874338 6:45079013-45079035 ATTTTGTTACATATATTGCTGGG + Intronic
1007972884 6:46070495-46070517 GTCTGGTTAGCTGTATTCCTAGG - Intronic
1008355657 6:50549624-50549646 TTCAGGATAGGAATATTGCTTGG - Intergenic
1009749585 6:67866871-67866893 TTCTTGTTAGTTGTATTTCTAGG - Intergenic
1009779564 6:68252623-68252645 CCTTGGTTAGATATATTCCTAGG + Intergenic
1009803173 6:68568754-68568776 TCTTGGTTAGATGTATTCCTAGG + Intergenic
1010054446 6:71548530-71548552 TCTTGGTTAAATATATTCCTAGG + Intergenic
1010158898 6:72828444-72828466 TCTTGGTTAAATTTATTGCTAGG + Intronic
1010296357 6:74201882-74201904 TATTGGTTAAATATATTCCTAGG + Intergenic
1010546603 6:77165630-77165652 CTTTGGTTAAATATATTTCTAGG + Intergenic
1010611705 6:77961869-77961891 TTTTGCTTAGATGAATTGCTAGG + Intergenic
1011063414 6:83297232-83297254 CTCTGGTTAGCTGTATTGCTAGG - Intronic
1011140934 6:84155658-84155680 TCTTGGTTAAATATATTCCTAGG - Intronic
1011445955 6:87440174-87440196 TTTTGGTTAGATTTATTTGTAGG + Intronic
1011886677 6:92105187-92105209 CCTTGGTTAGATATATTCCTAGG + Intergenic
1011958453 6:93054732-93054754 TCTTGGTTAAATATATTCCTAGG + Intergenic
1012149406 6:95727610-95727632 TTGTGGTTTTATATATTTCTGGG + Intergenic
1012770565 6:103428136-103428158 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1013432999 6:110072280-110072302 TCTTGGTTAGATGTATTCCTGGG - Intergenic
1013605589 6:111744614-111744636 ATCTGGTTAGTGATAATGCTGGG - Intronic
1013885053 6:114953420-114953442 TTCTGGTTAAAATTATTCCTTGG + Intergenic
1014321771 6:119938714-119938736 CTTTGGTTATATGTATTGCTAGG + Intergenic
1014334953 6:120121838-120121860 TCGTGGTTAGATGTATTCCTAGG + Intergenic
1014339930 6:120191528-120191550 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1014578533 6:123105402-123105424 TTTTGGTTAGATATATTCCTAGG + Intergenic
1014838778 6:126192163-126192185 ATCTGGTTAAATGTATTCCTAGG + Intergenic
1015021265 6:128478815-128478837 TTAGGTTAAGATATATTGCTAGG + Intronic
1015281392 6:131438242-131438264 CCTTGGTTAGATATATTCCTAGG - Intergenic
1015476361 6:133662917-133662939 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1016288632 6:142503384-142503406 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1016453250 6:144205448-144205470 TCCTGGTTAGCTATATTCCTAGG + Intergenic
1016586502 6:145693131-145693153 CTCTGGTTAGCTGTATTCCTAGG + Intronic
1017359130 6:153545485-153545507 TTCTGATTAGATTCATTGTTAGG - Intergenic
1017377148 6:153784484-153784506 TTCTTGTTAGCTCTATTCCTAGG - Intergenic
1017474970 6:154781262-154781284 TCCTTGTTAGCTATATTCCTAGG - Intronic
1017560179 6:155618669-155618691 CTTTGGTTAGATTTATTTCTAGG + Intergenic
1017876271 6:158527123-158527145 TCCTTGTTAGCTATATTCCTAGG - Intergenic
1018555132 6:165041385-165041407 TTCTGTTTACATTTATTTCTGGG + Intergenic
1018661780 6:166094206-166094228 TCCTGGTTAGTTGTATTCCTAGG + Intergenic
1018661882 6:166095589-166095611 TCCTGGTTAGTTGTATTCCTAGG + Intergenic
1018689884 6:166336362-166336384 TTCAGTTTAGATATATTGCATGG - Intronic
1019226968 6:170520760-170520782 TCCTAGTTAGATGTATTCCTAGG - Intergenic
1020476819 7:8605464-8605486 TTCTAGGTACATTTATTGCTAGG + Intronic
1020566667 7:9806329-9806351 TTATGGCTAGATCTATTGGTGGG - Intergenic
1021366239 7:19782831-19782853 CTCTGGTTAGTTGTATTCCTAGG + Intergenic
1021589553 7:22246002-22246024 CTCTAGTTAGATGTATTCCTAGG - Intronic
1021967582 7:25936347-25936369 CCCTGGTTAGCTATATTACTAGG - Intergenic
1023435974 7:40141062-40141084 TCTTGGTTAAATATATTCCTAGG + Intronic
1023644790 7:42299265-42299287 TCTTTGTTAGATATATTCCTGGG + Intergenic
1024336208 7:48208524-48208546 TTTTGGTTAGGTTTATTCCTAGG + Intronic
1024340793 7:48257026-48257048 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1027407316 7:77875294-77875316 CCCTGGTTAGATTTATTCCTAGG + Intronic
1028180606 7:87718062-87718084 TTCTGGTTTGATGATTTGCTAGG + Intronic
1028699818 7:93764420-93764442 CCCTGGTTAGATGTATTCCTAGG - Intronic
1028780822 7:94734269-94734291 CCCTGGTTAGATGTATTCCTAGG - Intergenic
1028814839 7:95131907-95131929 TCTTGGTTAGATGTATTCCTAGG + Intronic
1030242272 7:107341301-107341323 TCATGGTTAGATGTATTCCTAGG - Intronic
1030475456 7:110027204-110027226 TTCTCATTAAATATATTGCTTGG - Intergenic
1030492953 7:110262018-110262040 TTCTTTATAGATATATTTCTAGG - Intergenic
1030572997 7:111250179-111250201 TTCTTGTTAGCTGTATTCCTAGG - Intronic
1030806585 7:113927637-113927659 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1030813339 7:114003749-114003771 TCCTGGTTAGTTGTATTCCTAGG - Intronic
1031093656 7:117392402-117392424 TCTTGGTTAGATGTATTCCTAGG + Intronic
1031259196 7:119495106-119495128 TTCTGGTTTGATGATTTGCTAGG + Intergenic
1031268844 7:119618590-119618612 TCCCGGTTAGATGTATTGCTAGG - Intergenic
1031309936 7:120183846-120183868 TCCTGGTTAGATTTTGTGCTGGG - Intergenic
1031385477 7:121145017-121145039 TGCTGGTTACATATATAACTAGG + Intronic
1031429677 7:121651588-121651610 CCCTGGTTAGCTATATTTCTAGG + Intergenic
1031751186 7:125576823-125576845 CTCTGGTTAGCTGTATTACTAGG - Intergenic
1033574163 7:142664036-142664058 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1035646839 8:1230287-1230309 TTCGAGTTAGATGTATTACTAGG - Intergenic
1036742315 8:11374786-11374808 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1036836627 8:12075415-12075437 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1036858470 8:12321982-12322004 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1037382201 8:18298049-18298071 TTTTGGTTAGATGTATTCCTAGG + Intergenic
1037508603 8:19557936-19557958 CTTTTGTTAGATTTATTGCTAGG - Intronic
1037508710 8:19559717-19559739 CTTTTGTTAGATTTATTGCTAGG - Intronic
1039007619 8:33057898-33057920 CTCTGGTTAGCTGTATTACTAGG + Intergenic
1039114928 8:34082281-34082303 TTCTGGTTAGGTTTAGTGTTTGG + Intergenic
1040704199 8:50105748-50105770 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1041393618 8:57369428-57369450 GCGTGGTTAGATTTATTGCTAGG - Intergenic
1041470779 8:58206318-58206340 CTCTGGTTAGCTGTATTTCTAGG + Intergenic
1041560338 8:59210583-59210605 TCTTGGTTAGCTATATTCCTAGG + Intergenic
1042046167 8:64654444-64654466 CCCTGGTTAGTTATATTCCTAGG - Intronic
1042198098 8:66251384-66251406 TTCTTATTAGATATTTTACTAGG - Intergenic
1042631105 8:70817399-70817421 TCCTGGTTAGATGTATTCCTAGG - Intergenic
1042871255 8:73401662-73401684 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1043121208 8:76326832-76326854 TTCTGGTGATATATTTTGCTTGG - Intergenic
1043205759 8:77437178-77437200 TTCTGTTTAGATGTGTTTCTAGG + Intergenic
1043233149 8:77828106-77828128 TTTTGGTTAGATTTATAACTAGG + Intergenic
1043638526 8:82418195-82418217 TTATAGATAGATATATTGTTGGG + Intergenic
1043652106 8:82609514-82609536 TCCTGGTCAAATATATTCCTAGG + Intergenic
1045116170 8:98982993-98983015 CTCTGCATAGATATATTCCTTGG + Intergenic
1045674293 8:104589861-104589883 TTCAGGGTAGATATATTGAAAGG + Intergenic
1045819785 8:106322808-106322830 CTCTGGTTAGCTGTATTCCTAGG - Intronic
1046189738 8:110777841-110777863 CCCTTGTTAGATATATTCCTAGG - Intergenic
1046289879 8:112144618-112144640 TGCTTGTTCGATATATTTCTAGG + Intergenic
1046409346 8:113818851-113818873 CCTTGGTTAGATATATTTCTAGG - Intergenic
1047164754 8:122425218-122425240 CTCTGGTTAGATGTATTCTTAGG + Intergenic
1047171213 8:122494536-122494558 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1047525435 8:125629511-125629533 TTTTGGTTAAATTTATTCCTAGG - Intergenic
1047575275 8:126146601-126146623 CCCTGGTTAGATGTATTCCTAGG + Intergenic
1047630579 8:126702543-126702565 GTTTGGTTAGATATATTCTTAGG - Intergenic
1047813789 8:128439970-128439992 TTCTGGTTAGCTGCATTCCTAGG - Intergenic
1047855664 8:128908009-128908031 TTCTGGTTAGTTTAATTTCTAGG + Intergenic
1049115636 8:140684632-140684654 CCCTGGTTAGCTATATTCCTGGG - Intronic
1050003780 9:1106369-1106391 TTCTGGTTAGCTGTATTCCCAGG + Intergenic
1050042295 9:1509121-1509143 TTCCTGTTAGGTATATGGCTAGG + Intergenic
1050617011 9:7411939-7411961 CCCTGGTTAGCTATATTCCTAGG - Intergenic
1050648230 9:7745531-7745553 TTTTGATTAGATGTATTCCTAGG + Intergenic
1050675450 9:8047564-8047586 TTCTGATTAGCTGTATTACTGGG + Intergenic
1050805099 9:9666994-9667016 TTCTCTTTAAATATATTACTTGG + Intronic
1051286241 9:15499961-15499983 TTCTGTTTAGCAATATTACTTGG - Intronic
1051703634 9:19853034-19853056 CCCTTGTTAGATGTATTGCTGGG + Intergenic
1051842120 9:21410399-21410421 TTCTGGTGAGATAAATTCATTGG - Intronic
1051962206 9:22780516-22780538 TTCTGGTTAGCTCTATTCCTAGG + Intergenic
1052377799 9:27737462-27737484 CTCTGGTTAGCTATATTCCTAGG + Intergenic
1052573524 9:30261657-30261679 ATTTGGTTAAATTTATTGCTAGG + Intergenic
1052767343 9:32654807-32654829 TTCTGGTTAACTGTATTCCTAGG - Intergenic
1054739931 9:68794943-68794965 TGCTGGTTACAAATATGGCTTGG - Intronic
1055067140 9:72130393-72130415 TTTTGGTGAGATCTAATGCTTGG + Intronic
1055330719 9:75180455-75180477 TTGTTGTTAGATTTATTCCTAGG + Intergenic
1055908799 9:81323978-81324000 TTTTGGTTAAATTTATTTCTAGG + Intergenic
1056053902 9:82800555-82800577 TGCTGGTTTGATATATTACAAGG + Intergenic
1056309777 9:85328431-85328453 CTTTGGTTAGGTATATTCCTAGG - Intergenic
1056474002 9:86935303-86935325 TTCTTCTTAGATTTATTCCTAGG - Intergenic
1056919956 9:90778546-90778568 CTCAGGTTAGATAATTTGCTAGG + Intergenic
1057697210 9:97332591-97332613 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1057861578 9:98644961-98644983 TTGGGGTAACATATATTGCTGGG - Intronic
1058327117 9:103712418-103712440 CCTTGGTTAGATATATTCCTAGG + Intergenic
1058386170 9:104438559-104438581 TTCTTGTTAGCTGTATTCCTAGG + Intergenic
1058403352 9:104642335-104642357 TCCTGGTTAGATGTATTCTTAGG - Intergenic
1058728866 9:107830466-107830488 TTTTGGTTAAATGTATTCCTAGG + Intergenic
1059036438 9:110758833-110758855 TCCTGGTTAGCTGTATTCCTCGG - Intronic
1059166675 9:112083180-112083202 TTCTAGTTAGGTTTATTTCTAGG - Intronic
1059891086 9:118805272-118805294 CTTTGGTTAGATGTATTACTAGG - Intergenic
1062714606 9:138001832-138001854 TTTTAGTTAGATTTATTTCTGGG - Intronic
1203464932 Un_GL000220v1:76774-76796 CTCTTGTTAGATACATTCCTTGG - Intergenic
1186938792 X:14481090-14481112 CCTTGGTTAGATATATTCCTAGG + Intergenic
1187298277 X:18023855-18023877 TTCTGTATAGATATAATGGTTGG + Intergenic
1187607442 X:20901488-20901510 CCCTGGTTAGCCATATTGCTAGG + Intergenic
1187702882 X:21980916-21980938 TTCTTGTTAAATATATTCCTAGG - Intronic
1188230022 X:27650515-27650537 CCTTGGTTAGATGTATTGCTAGG + Intronic
1188371311 X:29373141-29373163 CTCTGGTTAAATATATTCCTAGG + Intronic
1188848902 X:35108161-35108183 CCTTGGTTAGATATATTTCTAGG - Intergenic
1188963259 X:36519150-36519172 TGCTGGTTACATTTATTGATAGG + Intergenic
1189188882 X:39078801-39078823 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1189637744 X:43029799-43029821 TTCTTGTTAGATGTATTATTAGG - Intergenic
1189678720 X:43491441-43491463 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1189861606 X:45277719-45277741 CCCTGGTTAGTTATATTTCTAGG + Intergenic
1189891461 X:45607223-45607245 CCCTGGTTAGCTATATTCCTAGG + Intergenic
1189898123 X:45677419-45677441 CTCTGGTTAGCTATATTCCTAGG - Intergenic
1190499981 X:51065240-51065262 TTTTGGTTAAATGTATTCCTAGG - Intergenic
1190599334 X:52073552-52073574 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1190609490 X:52180521-52180543 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1191021349 X:55864070-55864092 TTCTGGTTAGCTGTATTTCTAGG - Intergenic
1191037261 X:56039943-56039965 TTCTTGTTAGCTCTATTCCTAGG + Intergenic
1191072329 X:56414031-56414053 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1191224039 X:58021663-58021685 CTCTGGTTAGTTGTATTTCTAGG - Intergenic
1191817310 X:65260320-65260342 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1191821984 X:65320319-65320341 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1193044873 X:77041965-77041987 CCCTGGTTAGCTATATTTCTAGG - Intergenic
1193060248 X:77198565-77198587 TCTTGGTTAGATGTATTCCTAGG + Intergenic
1193188516 X:78541328-78541350 TCCTGGTTAGCTGTATTTCTAGG + Intergenic
1193189995 X:78559519-78559541 TTCTTGTTAGCTGTATTCCTAGG + Intergenic
1193265915 X:79469055-79469077 CTTTGGTTATGTATATTGCTAGG - Intergenic
1193405895 X:81101753-81101775 TCCTGTTTAGTTATATTCCTAGG + Intergenic
1193497181 X:82229755-82229777 TTATGTTAAGATCTATTGCTGGG + Intergenic
1193597422 X:83464038-83464060 TTCTGGTTTGAGATATGGCAAGG + Intergenic
1193613661 X:83662383-83662405 CTCTGGTTAGCTGTATTCCTAGG + Intergenic
1193624961 X:83807243-83807265 CTTTGGTTAGCTGTATTGCTGGG + Intergenic
1193655694 X:84194707-84194729 TCCTCGTTAAATTTATTGCTAGG + Intergenic
1193710887 X:84878340-84878362 TTCTGTTTTCATATATTGCCTGG + Intergenic
1193858398 X:86634711-86634733 TCTTGGTTAAATATATTCCTAGG - Intronic
1193920551 X:87420163-87420185 ACCTGGTTAGATGTATTTCTAGG - Intergenic
1193946859 X:87748223-87748245 TTCTTGTGATATATATTTCTTGG + Intergenic
1193960412 X:87917994-87918016 CTCTTGTTAGCTATATTCCTAGG - Intergenic
1194020772 X:88689953-88689975 ACTTGGTTAGATATATTGGTAGG - Intergenic
1194022472 X:88709245-88709267 TCCTGGTTAGTTTTATTCCTAGG + Intergenic
1194129932 X:90069236-90069258 TTTTGGTTAGCTGTATTCCTGGG + Intergenic
1194217149 X:91144806-91144828 TCCTGGTTTGCTATATTGCTTGG + Intergenic
1194261069 X:91696704-91696726 TCTTGGTTAGTTATATTCCTAGG + Intergenic
1194290127 X:92062035-92062057 CTCTGGTTAGTTCTATTCCTAGG + Intronic
1194365003 X:93004080-93004102 TCCTGGTTAGCTATATTCATAGG + Intergenic
1194394088 X:93358756-93358778 TCTTGGTTAAATATATTCCTAGG - Intergenic
1194517854 X:94879089-94879111 TTCTTGTTAGCTGTATTCCTAGG - Intergenic
1194805443 X:98321252-98321274 TTGTTGTTAGCTATATTCCTAGG + Intergenic
1194912684 X:99666438-99666460 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1194926482 X:99831381-99831403 TTCTGGTTAGCTATATTTCTTGG - Intergenic
1194948481 X:100096308-100096330 TCCTGGTTAACTATATTCCTAGG - Intergenic
1195489963 X:105456038-105456060 CTCTGGTTAGCTGTATTCCTAGG + Intronic
1195784460 X:108503681-108503703 CTTTGGTTAAATATATTCCTAGG - Intronic
1196040611 X:111199045-111199067 TCCTGGTTAGCTGTATTCCTAGG + Intronic
1196052147 X:111316847-111316869 CCCTGGTTAGCTGTATTGCTAGG - Intronic
1196244697 X:113387122-113387144 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1196534223 X:116822757-116822779 TTTTGGTTACATTTATTCCTAGG - Intergenic
1196536618 X:116852911-116852933 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1196592382 X:117501718-117501740 GTTTGGTTAGATTTATTCCTAGG - Intergenic
1196949482 X:120862574-120862596 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1197023887 X:121723581-121723603 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1197063442 X:122210965-122210987 TTCTGCTTAGATTTATTCTTAGG + Intergenic
1197391028 X:125864852-125864874 TCTTTGTTAGATATATTCCTAGG - Intergenic
1197625451 X:128796997-128797019 TCCTGGTTAGCTGTATTCCTAGG - Intergenic
1197993130 X:132339929-132339951 TCTTGGTTAAATATATTCCTAGG + Intergenic
1197993598 X:132347044-132347066 TCTTGGTTAGATGTATTCCTAGG - Intergenic
1198232149 X:134700712-134700734 CTTTGGTTAGATGTATTCCTAGG - Intronic
1198367869 X:135960381-135960403 GTCTGGTTAGATATGCTTCTGGG - Intergenic
1198723841 X:139655340-139655362 TTTTGGTTAGATTGATTCCTAGG + Intronic
1199146754 X:144378163-144378185 TCCTGGTTAGCTGTATTCCTGGG + Intergenic
1199150711 X:144482207-144482229 CTCTGGTTAGCTGTATTCCTAGG - Intergenic
1199158717 X:144581887-144581909 TATTGGTTAAATATATTCCTAGG + Intergenic
1199183218 X:144882970-144882992 GTCTGGTTAGCTGTATTCCTAGG - Intergenic
1199193045 X:144994723-144994745 CTTTGGTTAGATGTATTCCTAGG + Intergenic
1199304414 X:146250635-146250657 TTTTGGTTAAATAAATTCCTAGG - Intergenic
1199368252 X:147014203-147014225 TTTTGGTTAAATGTATTCCTAGG - Intergenic
1199913844 X:152316880-152316902 TTCTGTTTTGACATATTTCTGGG - Intronic
1200035499 X:153326287-153326309 TCCTGGTTAGCTGTATTCCTAGG + Intergenic
1200553666 Y:4608597-4608619 TCCTGGTTTGCTATATTGCTTGG + Intergenic
1200579718 Y:4935507-4935529 TCTTGGTTAGTTATATTCCTAGG + Intergenic
1200607642 Y:5286609-5286631 CTCTGGTTAGTTCTATTCCTAGG + Intronic
1200673230 Y:6120338-6120360 TCCTGGTTAGCTATATTCATAGG + Intergenic
1201456475 Y:14172620-14172642 TTCTGTTTATTTATTTTGCTTGG - Intergenic
1201934842 Y:19397728-19397750 TTGTTTTTAGATATTTTGCTTGG + Intergenic