ID: 1099630154

View in Genome Browser
Species Human (GRCh38)
Location 12:85132376-85132398
Sequence GTGGCTTCTTCCTGCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099630154_1099630159 -1 Left 1099630154 12:85132376-85132398 CCTCCCTAGCAGGAAGAAGCCAC 0: 1
1: 1
2: 0
3: 20
4: 205
Right 1099630159 12:85132398-85132420 CTTGGCCCATTTGCCATGTTAGG 0: 1
1: 0
2: 0
3: 26
4: 282
1099630154_1099630163 6 Left 1099630154 12:85132376-85132398 CCTCCCTAGCAGGAAGAAGCCAC 0: 1
1: 1
2: 0
3: 20
4: 205
Right 1099630163 12:85132405-85132427 CATTTGCCATGTTAGGGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1099630154_1099630160 0 Left 1099630154 12:85132376-85132398 CCTCCCTAGCAGGAAGAAGCCAC 0: 1
1: 1
2: 0
3: 20
4: 205
Right 1099630160 12:85132399-85132421 TTGGCCCATTTGCCATGTTAGGG 0: 1
1: 0
2: 2
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099630154 Original CRISPR GTGGCTTCTTCCTGCTAGGG AGG (reversed) Intronic
900806647 1:4771898-4771920 GTGGGTCCTTCCTGCCAGAGGGG - Intronic
901419861 1:9143569-9143591 GTGGCCTCTTCCTGCGATGGAGG + Intergenic
903295065 1:22338551-22338573 GAGGTTTCTTCCAGCTAGGACGG + Intergenic
903763533 1:25716581-25716603 GTGGCTTATGCCTGTTTGGGAGG - Intronic
904751156 1:32742014-32742036 GGGACTTCTTCCTGCGCGGGGGG - Exonic
906621339 1:47283212-47283234 TTTTGTTCTTCCTGCTAGGGAGG - Intronic
910617441 1:89215234-89215256 CTGGCTGCTTCCTGCTGAGGAGG - Intergenic
913697335 1:121340017-121340039 GTGCCTTCGCCCAGCTAGGGTGG + Intronic
914140223 1:144940036-144940058 GTGCCTTCGCCCAGCTAGGGTGG - Intronic
915059256 1:153166608-153166630 GTTGCTTCTACCTGGTTGGGTGG - Intergenic
915646110 1:157273834-157273856 CTGGCTACTTCCTGCTGGGAAGG + Intergenic
916809073 1:168289848-168289870 GTAGTTTCTGCCTGCTAGGCAGG - Intronic
919836534 1:201578514-201578536 GTGCCTTATTACTGCTAGGTGGG + Intergenic
920461753 1:206145852-206145874 GTCTCTTCTTTCTGCTTGGGTGG - Intergenic
920484668 1:206358349-206358371 GTGCCTTCGCCCAGCTAGGGTGG + Intronic
920567469 1:206986375-206986397 GTGGCTTTTTCCTTCTAGTAAGG + Intergenic
921147040 1:212367857-212367879 TTGGGTCCATCCTGCTAGGGTGG - Intronic
1065665861 10:28059718-28059740 CTGGCTTCTTCTTGCTCTGGTGG + Exonic
1066495037 10:35934397-35934419 CTGGCTTCCTGCTGCTAGGGGGG + Intergenic
1067479810 10:46587406-46587428 GTTGCTACTTCCTCCTGGGGAGG + Intronic
1067614927 10:47754391-47754413 GTTGCTACTTCCTCCTGGGGAGG - Intergenic
1071132875 10:82416320-82416342 GTGCCGTCTTCCTGCTATGCAGG - Intronic
1071630332 10:87214355-87214377 GTTGCTACTTCCTCCTGGGGAGG - Intergenic
1072370752 10:94764581-94764603 GTAGCTACTTCCTGCTGGAGAGG + Intronic
1075951492 10:126481674-126481696 TTGGCTTCTTCATTTTAGGGTGG - Intronic
1076350871 10:129814384-129814406 ATGGCACCTTCCTGCCAGGGTGG - Intergenic
1076444889 10:130507564-130507586 GTGCCTTTTTCCTGCTGGGTGGG + Intergenic
1079131754 11:17750765-17750787 ATGGATGCTTCCTGCTAGGCCGG + Intronic
1079222479 11:18575906-18575928 CTGGCTTCTTCCTGCTGAGGGGG - Intronic
1080856504 11:36116298-36116320 CTGGCTTCTTGCTGGTAGGCAGG - Intronic
1085216330 11:74836010-74836032 GTGGCTTCTCCTTGCTAGAATGG - Exonic
1089164169 11:116461951-116461973 GTGGCTTCCCCCTGCAGGGGTGG + Intergenic
1092226560 12:6752152-6752174 ATGCCTACTTCCTGCTAGGTAGG + Intronic
1092477662 12:8832703-8832725 CTGGCTTCTTCCTGCTGAGAGGG + Intronic
1093024004 12:14230146-14230168 GTGGCATCTTGCTTCTGGGGAGG - Intergenic
1096884455 12:54702282-54702304 GAGGCTGCTTGCTGCTGGGGTGG + Intergenic
1099175189 12:79413193-79413215 GTGGCTTCTTTCTTCAAAGGAGG - Intronic
1099630154 12:85132376-85132398 GTGGCTTCTTCCTGCTAGGGAGG - Intronic
1102512111 12:113422699-113422721 GTGGGTTCTGCCTGCCAGAGGGG + Intronic
1106109298 13:26762260-26762282 GTGGCTTGTTCATGGTGGGGAGG + Intergenic
1108152153 13:47547550-47547572 CTGTCCTCTGCCTGCTAGGGTGG + Intergenic
1108867141 13:54937652-54937674 CTGGCTGCTTCCTGCTGGGAAGG + Intergenic
1109390433 13:61684899-61684921 GTGTCTTCTTCATGGGAGGGTGG - Intergenic
1110712464 13:78664949-78664971 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
1111487250 13:88919842-88919864 GTTACTTGTTACTGCTAGGGTGG - Intergenic
1111558578 13:89913356-89913378 CTGGCTTCTTCATGCTGAGGAGG - Intergenic
1116289072 14:43008487-43008509 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
1117156809 14:52950567-52950589 ATGGCTCCTTCCTGCGAGCGCGG + Exonic
1117874584 14:60238974-60238996 GTGGCTTCTTCCTGTCAGTCAGG + Intergenic
1118561080 14:67083459-67083481 GTGGCTTTTTTCTTCTGGGGAGG - Intronic
1119565582 14:75626426-75626448 GTGGCTTCATCCTGGTAGAGGGG + Intronic
1120318467 14:82928495-82928517 GTGGCTGCTTACTGATAGGGTGG + Intergenic
1120402390 14:84048370-84048392 GTGGCCTTTTCCTGCTAGTTGGG - Intergenic
1120405760 14:84091598-84091620 GTAGCTCCTTTCTGCTAGGTAGG - Intergenic
1121414602 14:93770420-93770442 GTGGCTGCTGCCTGCTACGAGGG - Intronic
1122739222 14:103861543-103861565 GACGCTGCTGCCTGCTAGGGAGG + Intergenic
1127413416 15:58732104-58732126 GTGGCTTCTTCCCCATTGGGAGG - Intronic
1128311412 15:66633559-66633581 GTGGGGACTTCCTGCTGGGGGGG - Intronic
1130379199 15:83357309-83357331 GTGGCTTCTTCCTGCCAGGGAGG - Intergenic
1132668823 16:1094534-1094556 CAGGCTTCTTCCTGCTTGCGGGG + Intronic
1132766734 16:1538159-1538181 GTGCCTCCTTCCTGGCAGGGCGG + Intronic
1133168222 16:3964079-3964101 GTGACTTCTTCATGCCGGGGAGG + Exonic
1135057045 16:19240407-19240429 GTAGCTTCTCTCTGCTAGGCAGG + Intronic
1136450234 16:30350601-30350623 GTGGCTGCCTCTTGCTAGGGTGG - Intergenic
1136605982 16:31334024-31334046 GTGGCTGCTTCCTCAGAGGGAGG + Intergenic
1137460306 16:48655381-48655403 CTGGCTTCTTCCTGCTGAGAGGG + Intergenic
1138056560 16:53840245-53840267 TTGGCTGCTTCATTCTAGGGGGG - Intronic
1139343822 16:66289326-66289348 GTGGCTTCTCCCTGGGGGGGGGG + Intergenic
1139551915 16:67678283-67678305 GGGGTTTCTTCCTGCTAGTTAGG - Intronic
1139587227 16:67911801-67911823 GGGACTTCCTCCTGCTGGGGAGG + Intronic
1141627089 16:85267017-85267039 CTGGCTCCTTCCTGCCCGGGAGG + Intergenic
1144264834 17:13558155-13558177 GTAGCTCCTTGCTGCTTGGGAGG + Intronic
1146915577 17:36676324-36676346 CTGATTTCTCCCTGCTAGGGAGG - Intergenic
1148343601 17:46888868-46888890 GTAGCTTGCTCCTGGTAGGGTGG - Intergenic
1149349974 17:55776536-55776558 GTGATTTCTTCCAGCTTGGGAGG + Exonic
1149674508 17:58447287-58447309 TTGGGTCCTTCCTGCTGGGGTGG - Intronic
1150273249 17:63880309-63880331 GTGGCTTCTAGCTGCCCGGGTGG - Exonic
1150278857 17:63917297-63917319 GTGGCTTCTAGCTGCCCGGGTGG - Exonic
1150828146 17:68494745-68494767 GTGGCTTCTGCTTGGTGGGGAGG - Intergenic
1151224070 17:72635503-72635525 GTGGGTTATGCCTGCTTGGGAGG - Intergenic
1151666916 17:75550299-75550321 GTGGGTACTTCCTTTTAGGGAGG + Intronic
1152204851 17:78969133-78969155 GTGGGTCCTGCCTGCAAGGGAGG - Intergenic
1152340540 17:79721664-79721686 TTGGCATCTGCCTGCTGGGGAGG + Intergenic
1154142215 18:11834262-11834284 CCAGCTTATTCCTGCTAGGGAGG + Intronic
1154342596 18:13516538-13516560 GTGGCTCTTTATTGCTAGGGTGG + Intronic
1155250613 18:23949849-23949871 GGGGTGTCTTCCTGCTTGGGTGG + Exonic
1159608254 18:70497705-70497727 GGGGCTTCCGCCTGCTAAGGAGG + Intergenic
1160625459 18:80201336-80201358 GTGGCTGCTTGCTGCTTGGCTGG - Intronic
1161078818 19:2300446-2300468 GTGGCAGCTTCCTGGGAGGGGGG - Intronic
1161114441 19:2488920-2488942 GGGACTCCTGCCTGCTAGGGAGG - Intergenic
1161368155 19:3893116-3893138 GTGGCTTCGTCCTGCTGAGGTGG - Intronic
1162193100 19:8962542-8962564 CTGGCTTCATCCTGAAAGGGAGG + Exonic
1165079874 19:33301111-33301133 GTGGCTTCTCCCTGCGAGGAGGG - Exonic
1168574483 19:57498766-57498788 GGGGCTTCTTGCTTCTAGTGAGG - Intronic
927090886 2:19711705-19711727 TTGGCTTCATCCTGCATGGGAGG - Intergenic
928071466 2:28221771-28221793 GTGACTTCTGCCTCCTAGGCAGG - Intronic
933368853 2:81389681-81389703 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
935352502 2:102164955-102164977 TTGGTTTGTTCCTGCTAAGGTGG + Exonic
936607377 2:113972041-113972063 GTGACTGCTTCCAGGTAGGGAGG - Intergenic
936846361 2:116839906-116839928 GTGTGTTCTTCCTTCTAGGAGGG + Intergenic
937144327 2:119629440-119629462 GTGGCTTCAACCTGCCATGGAGG + Intronic
937237247 2:120438283-120438305 GTAGCTCCTGCCTGCTGGGGTGG - Intergenic
937568685 2:123330455-123330477 GTGGCTTGCTGGTGCTAGGGTGG + Intergenic
940697777 2:157001402-157001424 ATGGCTTCTTCCTGCTGCAGAGG - Intergenic
942392509 2:175510374-175510396 TCGGCTTCTTGCTGCTAGGAGGG + Intergenic
944110243 2:196124216-196124238 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
946022963 2:216654254-216654276 GTGGGTACTTCCTGGTAGGCAGG + Intronic
948395711 2:237643484-237643506 GTGGCTTTTTCCTGCTCAGACGG + Intronic
1169542592 20:6616587-6616609 GTGGCTTCATTCAGCTGGGGTGG + Intergenic
1173732449 20:45338218-45338240 GTGGCTACTTCCTGCTTGTGTGG - Intronic
1174399158 20:50266755-50266777 GTGGCACCTTCCTTCTAGGGAGG - Intergenic
1174419396 20:50389884-50389906 GGGGCTTCTTCCTGGGATGGGGG - Intergenic
1174430906 20:50468182-50468204 GCCGCTTCTTGCTGCAAGGGAGG - Intergenic
1175132059 20:56796664-56796686 CTGGCTTCTGCCTGCCAGGTGGG + Intergenic
1175262140 20:57681348-57681370 GGGCCTCCTTCCTGCCAGGGAGG + Intronic
1175810247 20:61853808-61853830 GTGGCTGCCTCCTGCATGGGGGG + Intronic
1176172322 20:63701583-63701605 GAGGCCTCTTCCTGCTATGCAGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177306310 21:19321296-19321318 GTGGCTTCTTCCTCCTGAAGTGG - Intergenic
1177714709 21:24824026-24824048 GTGGCTTCATACTGGTAGGCTGG + Intergenic
1178624689 21:34204844-34204866 GCAGCTTCTTCCTGCTGGAGAGG + Intergenic
1179442870 21:41407769-41407791 GGGGCTTCTTAGTGCTAGAGGGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179947162 21:44686316-44686338 CTGGCATCTTCCTCCTTGGGTGG - Intronic
1181981265 22:26768507-26768529 GTGGTTGCTTTCTGCTGGGGTGG + Intergenic
1184130524 22:42514294-42514316 TTAGCTTCTTCCTGCAAGGAAGG + Exonic
1184140700 22:42576116-42576138 TTAGCTTCTTCCTGCAAGGAAGG + Intergenic
1185197413 22:49480993-49481015 GTGGCATCTCCCTGCAAGTGGGG + Intronic
950310940 3:11957151-11957173 ATGGCAGCTTCCTGCTGGGGAGG - Intergenic
952026013 3:29082920-29082942 GTCACTTCTAGCTGCTAGGGTGG + Intergenic
953802902 3:46041539-46041561 CTGGCTGCTTCATGCTAAGGAGG - Intergenic
954434448 3:50488639-50488661 GTGGGCACTTCTTGCTAGGGGGG - Intronic
954800828 3:53186067-53186089 CTGGCTTCTTCCCGCTTAGGTGG + Intronic
956686662 3:71835429-71835451 TTGGCTTCTTCCAGCTAGACTGG + Intergenic
959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG + Intergenic
960845274 3:121998988-121999010 ATGACTTCTGCCTTCTAGGGTGG + Intronic
961664698 3:128488210-128488232 GTGGTTAGTTACTGCTAGGGAGG - Intronic
961717078 3:128865083-128865105 GTGGCTTGTGCCTGCGTGGGAGG + Intergenic
963112180 3:141696896-141696918 TTGGCTACTTCCTGCTGGGAAGG + Intergenic
963922116 3:150915932-150915954 GTGGCTTCTGGTTGCAAGGGAGG + Intronic
966687973 3:182716474-182716496 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
966861274 3:184232113-184232135 CAGGCTTCTTCCTGTTATGGGGG + Intronic
968646760 4:1744903-1744925 GGGGCTTCTCCCTGCTTGGAGGG - Intronic
968934361 4:3602215-3602237 GTGGCATATTCGAGCTAGGGTGG + Intergenic
971209801 4:24604787-24604809 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
971813849 4:31462091-31462113 CTGGCTTCTTCCTGCTGACGGGG + Intergenic
975699950 4:77054693-77054715 GTGGCTTCTACCTGCCAGTTTGG + Intronic
976226483 4:82798615-82798637 GGGGCTTCTGCCTTTTAGGGGGG + Exonic
976734167 4:88294121-88294143 GTGCCATCTTCCTTCCAGGGAGG + Intergenic
977505176 4:97893089-97893111 TTAGCTTCTTCCAGTTAGGGAGG + Intronic
977839684 4:101687461-101687483 GTGGCTTCTCCCTGCAATGATGG + Intronic
980724745 4:136743506-136743528 CTGGCTTCTTCCTGCTGAGGAGG + Intergenic
981726470 4:147852538-147852560 GTGCCTTCTCCCTGCTGGAGTGG + Intronic
981748015 4:148069371-148069393 CTGGCTTCTGCCTTCCAGGGAGG + Intronic
983063104 4:163180002-163180024 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
983063845 4:163188165-163188187 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
984095557 4:175428471-175428493 GTTGCTGCTGCCGGCTAGGGTGG - Intergenic
985207066 4:187550159-187550181 CTGGCTGCTTCCTGCTGAGGAGG + Intergenic
986290380 5:6394957-6394979 GTGGGTTCTTCCAGCTGAGGGGG - Intergenic
986827064 5:11533369-11533391 ATGGCTCCTTCCACCTAGGGTGG + Intronic
987158181 5:15112461-15112483 TTGGCTTCTTTGTGCAAGGGCGG + Intergenic
992141922 5:73807109-73807131 GTGGGTTCTTCCTAATAGGAGGG + Intronic
994489488 5:100423506-100423528 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
997404488 5:133634114-133634136 GTGCCTTCTTCCTGCTGGTGGGG + Intergenic
997985888 5:138501431-138501453 GTGGCTCCTTCCTCCTCTGGGGG - Intergenic
998112239 5:139511188-139511210 GTGGCTACTTCCTGCTGGATGGG - Intergenic
1001953508 5:175832431-175832453 GTGGGTTCTTTCTGCCAGGCTGG + Intronic
1002163102 5:177328395-177328417 CCGGCTCCTTCCAGCTAGGGCGG - Intergenic
1002682389 5:180976967-180976989 TTTGCTACTTCCTGCTGGGGGGG + Intergenic
1002717363 5:181235860-181235882 GTGGCTTCTCACTGCAGGGGCGG - Intergenic
1004987447 6:21098705-21098727 GTGGGTTCTTTCTGTTTGGGAGG + Intronic
1006796753 6:36737084-36737106 GTGGCCTCATCCTGCTGGTGGGG + Intergenic
1007710948 6:43823984-43824006 CTGGCTCCTTCATGCAAGGGAGG - Intergenic
1009625981 6:66139298-66139320 GTGGCTGCCTTCTGCTAGTGAGG + Intergenic
1013048569 6:106510915-106510937 GTGGCTTCTTACTGTTCTGGAGG + Intergenic
1013173727 6:107660013-107660035 GCGGCTTCTTCCTGCCTGGGTGG - Exonic
1015516523 6:134087895-134087917 GTGGCTTCTCCTTGCCTGGGAGG + Intergenic
1016212362 6:141553622-141553644 ATGGCCTCTTGATGCTAGGGGGG + Intergenic
1016493116 6:144629314-144629336 GTGGCTGCCTCTTGCAAGGGCGG - Intronic
1018769642 6:166959392-166959414 GTGGCTTCTTCAGGCTGGGTAGG - Intergenic
1018974787 6:168556212-168556234 GTGGCCTCTCCCGGCTGGGGTGG + Intronic
1021728339 7:23571729-23571751 GTGGTGTGTACCTGCTAGGGAGG + Intergenic
1023761026 7:43465416-43465438 GTGGCTTGTTCCTGCTCCTGTGG + Intronic
1025859246 7:65311125-65311147 CTGGCTACTTCCTGCTGAGGGGG - Intergenic
1025969574 7:66309607-66309629 GTGGTTTCTCTCTGGTAGGGAGG + Intronic
1026024675 7:66734822-66734844 GTGGCTTCCTCCTGCTCGGTTGG + Intronic
1026459914 7:70604798-70604820 GTGGCATCTAGCTGCAAGGGAGG + Intronic
1028482421 7:91322084-91322106 CTGGCCTCTTCCTGTCAGGGAGG + Intergenic
1029365602 7:100114227-100114249 GGGGCTTCATCCTTCCAGGGAGG - Exonic
1032703166 7:134399482-134399504 ATGGCTTTTTCCTGGTAGGTTGG - Intergenic
1035813686 8:2515220-2515242 CTGGCTTCTTCCTGCAGTGGGGG + Intergenic
1035864685 8:3069668-3069690 GTGGCTTTTTCATGCTGAGGGGG + Intronic
1037285106 8:17290877-17290899 TTGACTTCTTCCTGGTTGGGAGG + Intronic
1039484078 8:37898112-37898134 GTGCCTTCTTCTTACTAGGGTGG - Intronic
1045600393 8:103708245-103708267 TTGGGTTCTTCCTGCTGGGGTGG + Intronic
1049309878 8:141928161-141928183 GGGGCTTCTTCCTGCTTTGTTGG + Intergenic
1051215101 9:14789106-14789128 CTGGCTCCTTCCAGATAGGGAGG - Exonic
1052042253 9:23752339-23752361 TTTGCTTCCTCCTGCTAGGGAGG - Intronic
1053015082 9:34657291-34657313 CTGTCTTCTTCCTGGTGGGGAGG - Exonic
1054455792 9:65429766-65429788 GTGGCATATTCGAGCTAGGGTGG - Intergenic
1055115233 9:72598648-72598670 TTGCCTTCTGCCTGCTAGGAAGG + Intronic
1055318439 9:75057542-75057564 GTCACTTCTCCCTGCAAGGGAGG - Intergenic
1055410990 9:76029052-76029074 CTGGCTTCTTCCTGCTGTTGGGG + Intronic
1055492846 9:76824096-76824118 TTGCCTTCTTCCTGCTTAGGTGG - Intronic
1056427150 9:86488706-86488728 GTGGCTGCCTTCTGCTAGAGAGG - Intergenic
1057275806 9:93675488-93675510 GTGGCATCTTCCCCCTTGGGTGG + Intronic
1058446440 9:105059242-105059264 CTAGCTTCTTCCTGCTAGCAAGG - Intergenic
1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG + Intronic
1059619851 9:115991839-115991861 TTTGCTTCTTCCTGCTTGAGTGG + Intergenic
1060399169 9:123338112-123338134 GTGGCTTCCTCTTGCCAGTGAGG + Intergenic
1060430947 9:123551220-123551242 GTTGCTGCTTCCTGATAGAGGGG - Intronic
1061156465 9:128864968-128864990 GTGGCTTATGCCTGCAAGAGAGG + Intronic
1061237104 9:129349582-129349604 GTGGCTTCTTCAGGGGAGGGTGG + Intergenic
1062468186 9:136690743-136690765 GGGGCTCCTTCCTTCCAGGGAGG + Intergenic
1062523224 9:136968219-136968241 GGGGCTTCTTCCTGGGAGGGAGG + Intergenic
1185499439 X:585537-585559 ACGGCATGTTCCTGCTAGGGAGG - Intergenic
1185610303 X:1390457-1390479 GTGGCAGGTGCCTGCTAGGGAGG + Intronic
1188686640 X:33077496-33077518 CTGGCTTCTTCCTGCTGATGGGG + Intronic
1189853655 X:45201071-45201093 GTGGCTGCTTCAGGCTGGGGAGG + Intergenic
1190071824 X:47285953-47285975 CTGGCTACTTCCTGCTGAGGTGG + Intergenic
1192998582 X:76539010-76539032 CTGGCTGCTTCTTGCTAGAGAGG + Intergenic
1194176477 X:90655347-90655369 CTGGCTTCTTCCTGCTGAGGAGG - Intergenic
1199606783 X:149584829-149584851 GTGGCTTCTTTCTGCGTTGGGGG + Intronic
1199632340 X:149784539-149784561 GTGGCTTCTTTCTGCGTTGGGGG - Intronic
1200523104 Y:4236259-4236281 CTGGCTTCTTCCTGCTGAGGAGG - Intergenic
1201640523 Y:16171950-16171972 GTAGGTTATTCCTGCTAGGCAGG - Intergenic
1201662292 Y:16413376-16413398 GTAGGTTATTCCTGCTAGGCAGG + Intergenic