ID: 1099631514

View in Genome Browser
Species Human (GRCh38)
Location 12:85152317-85152339
Sequence CAGTGTTTGTGAAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099631514_1099631518 1 Left 1099631514 12:85152317-85152339 CCCGCTTCCCTTCACAAACACTG 0: 1
1: 0
2: 1
3: 20
4: 294
Right 1099631518 12:85152341-85152363 TTCTTTCAAACCAGCTGCATTGG 0: 1
1: 0
2: 1
3: 25
4: 237
1099631514_1099631521 21 Left 1099631514 12:85152317-85152339 CCCGCTTCCCTTCACAAACACTG 0: 1
1: 0
2: 1
3: 20
4: 294
Right 1099631521 12:85152361-85152383 TGGCCAAAGGTAACATGTCATGG 0: 1
1: 0
2: 2
3: 5
4: 139
1099631514_1099631519 8 Left 1099631514 12:85152317-85152339 CCCGCTTCCCTTCACAAACACTG 0: 1
1: 0
2: 1
3: 20
4: 294
Right 1099631519 12:85152348-85152370 AAACCAGCTGCATTGGCCAAAGG 0: 1
1: 0
2: 2
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099631514 Original CRISPR CAGTGTTTGTGAAGGGAAGC GGG (reversed) Exonic
900395307 1:2450928-2450950 CAGTGGTTGTGAGGGTGAGCAGG + Intronic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901254131 1:7806379-7806401 CTGTGTATGTGAAGTGAAGTAGG - Intronic
903589158 1:24441127-24441149 CAGTGCTGGTGGAGTGAAGCCGG - Intronic
904175828 1:28628085-28628107 CAGTGTTTTTCCTGGGAAGCTGG - Intronic
904500757 1:30911547-30911569 CAGTGTCTTTGAAGAGCAGCAGG - Intergenic
904891609 1:33783709-33783731 CAGTGTTAGTGTAGGAAAGATGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905641234 1:39591372-39591394 CAGTGTTTGTGAAATGGAGTTGG - Intergenic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
906989752 1:50725283-50725305 CAGTGATTCTGAAGCCAAGCTGG + Intronic
907069216 1:51519051-51519073 CGGTGTGTGTGAGGGAAAGCGGG - Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
911509862 1:98798448-98798470 CAGAGTCTGGGAAGGGAAGAGGG - Intergenic
912237802 1:107870851-107870873 CACTGTGTGTCATGGGAAGCAGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912776834 1:112510721-112510743 CAGTGTTGGGGAAGGCAAGGAGG + Intronic
913008996 1:114664314-114664336 GATTGATTGTGAACGGAAGCTGG + Intronic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
921612827 1:217232581-217232603 CAGTGTGTGTGAAAGCAAGAGGG + Intergenic
921958378 1:221008108-221008130 CAGAGGTTGGGAAGGGTAGCAGG - Intergenic
922317550 1:224456222-224456244 CAGAGCTTGTGAAAAGAAGCAGG - Intronic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
1062826878 10:576462-576484 CATTGTTTCTGAAGGAATGCCGG - Intronic
1063725281 10:8630416-8630438 CAGTGTGTGTGAAAGAAAGGGGG + Intergenic
1065483126 10:26214106-26214128 CAGTGAATGGGAAGGGAAGGCGG - Intergenic
1066796361 10:39125906-39125928 CAGAATTTGTGAAGGGACACTGG + Intergenic
1067090560 10:43264132-43264154 CAGGGTTTGGGAAGGTCAGCTGG - Intronic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1068892398 10:62161202-62161224 CAGTATCTGTGAAAGGAAGTAGG - Intergenic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1071209623 10:83324082-83324104 CAGAGGTTGTGAAGGGTAGCTGG + Intergenic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1077037696 11:503250-503272 CCGTCTTTCTGAAGGGCAGCTGG - Exonic
1078374748 11:10784443-10784465 CTGCGTTTGTGAAGGGGACCTGG - Intergenic
1078639393 11:13081107-13081129 AAGCCTTTGTGAATGGAAGCCGG - Intergenic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1080013671 11:27483027-27483049 AAGTGATTGTGAAGGGAAAATGG + Intergenic
1081235978 11:40647675-40647697 AAGTGTTTGGGAATGGTAGCTGG - Intronic
1081493391 11:43583525-43583547 CACTTATTGTGAAGGGAAGGGGG - Intronic
1081945379 11:46988555-46988577 CAGAGATTGGGAAGGGTAGCAGG + Intronic
1081950858 11:47041212-47041234 CAGGGTTGGGGAAGAGAAGCTGG + Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082767418 11:57180555-57180577 CAGTGTGTGGAAAGGGATGCTGG + Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1086225542 11:84503890-84503912 CAGTGCTTGTGAAGCTAAGAAGG - Intronic
1089573291 11:119423644-119423666 CAGTCTTTCTGAAAGGAAGCTGG + Exonic
1089681525 11:120121523-120121545 CAGTGCTTGGGCAGGGATGCCGG + Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090501547 11:127266006-127266028 CTGTGTCTGTGAGTGGAAGCTGG + Intergenic
1090555803 11:127874028-127874050 CATTCTTTTTCAAGGGAAGCAGG + Intergenic
1091131396 11:133150017-133150039 CAGTGTTAATCAAGGGATGCTGG - Intronic
1091296406 11:134476968-134476990 CAGTCTTTGTGAAGAGAAGGGGG + Intergenic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1093678220 12:21968814-21968836 CAGAGGTTGGGAAGGGCAGCTGG + Intergenic
1093869233 12:24266923-24266945 CAGTGTTGGTGAATAGAAGTAGG - Intergenic
1093902414 12:24651058-24651080 CAGAGGTTGGGAAGGGAAGTGGG - Intergenic
1094115450 12:26906976-26906998 CAGACTTTCAGAAGGGAAGCAGG + Intronic
1095819360 12:46460375-46460397 CAGAGTTTGGGAAGTGAATCTGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1097831789 12:64232629-64232651 CAGCATCTGTTAAGGGAAGCAGG - Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1101904817 12:108816670-108816692 CAGAGTCTGCCAAGGGAAGCAGG - Intronic
1103174188 12:118847651-118847673 CAGTGACTGTGTAGGGAGGCTGG + Intergenic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1104926511 12:132316739-132316761 CAGTGCTCGTGATGGGAAGGAGG - Intronic
1105409810 13:20161690-20161712 AAGTGTGTCTGAAGAGAAGCAGG - Intergenic
1108286015 13:48908623-48908645 CACTATTGCTGAAGGGAAGCTGG - Intergenic
1108286956 13:48918184-48918206 CATTTTTTGGGCAGGGAAGCAGG - Intergenic
1110662056 13:78067924-78067946 CAGTGTTTCTTCAGGAAAGCAGG + Intergenic
1110769366 13:79321179-79321201 AAGTGTTTATGAAGGGAATGGGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113573306 13:111374142-111374164 CAGGTTTTGTGTTGGGAAGCAGG - Intergenic
1114519638 14:23325144-23325166 CAGTTACTGTGAAGGGAAGGGGG - Intronic
1114734587 14:25030894-25030916 CTGAGTTTGTGAAGGAAATCGGG - Intronic
1115018565 14:28646871-28646893 TAGTGTTTGTAAAGGAAAACAGG - Intergenic
1119172431 14:72545304-72545326 AAGTGTTTGGGAAGGAAAGCAGG + Intronic
1119288755 14:73477544-73477566 CAGTATTTAGGAAAGGAAGCTGG + Intergenic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1121318573 14:92976956-92976978 CAGTGTTTGGGAAGCACAGCTGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1122403343 14:101480727-101480749 GGGTGTTTATGAAGGAAAGCGGG + Intergenic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1124033741 15:26034413-26034435 CAGGATTTTTGAAGGGAAGGAGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1125707193 15:41749108-41749130 CAGGGTCTGTGATGGGAATCCGG + Exonic
1125918877 15:43512647-43512669 GGGTGTCTGTAAAGGGAAGCAGG - Intronic
1126771284 15:52058845-52058867 CAGAATCTGTGTAGGGAAGCTGG + Intronic
1127542805 15:59959196-59959218 GAGTGTTTGTCAGGGGAAGGAGG - Intergenic
1128486558 15:68096716-68096738 CATTGTTTGTGTATGGAAACAGG + Intronic
1131406143 15:92166546-92166568 TAGTGTGAGTGAGGGGAAGCTGG - Intronic
1132505954 16:308985-309007 GAGTGTCTGTGCAGGGAAGTAGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1137553002 16:49453232-49453254 TGGGGCTTGTGAAGGGAAGCCGG - Intergenic
1138070412 16:53987665-53987687 CAGTGTTTATGATGGGAGGATGG - Intronic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1140942115 16:79731872-79731894 TAGTGTTTGTGAATTAAAGCTGG + Intergenic
1141022341 16:80509054-80509076 CAATGTCTGTGAAGGAAAGAAGG + Intergenic
1141289677 16:82706174-82706196 AAATGTTTGTGAAGGGAAAGAGG - Intronic
1141542023 16:84731887-84731909 CAGTGTTGGTGATGAGAAGAAGG + Intronic
1142252780 16:89000350-89000372 CAGCACGTGTGAAGGGAAGCAGG + Intergenic
1144430227 17:15184337-15184359 CAGAGGTTGGGAAGGGTAGCAGG + Intergenic
1144698417 17:17321349-17321371 TAGTGTCTGTGAAGGGCAGAGGG + Intronic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148836051 17:50466509-50466531 CAGTGTTTGTGCAGGGATTGTGG - Intronic
1149402800 17:56315852-56315874 CAATGTCTGTGAAGAGAAGATGG + Intronic
1149490460 17:57081216-57081238 AAGTGTCTGTGAAAGGAAGAAGG - Intergenic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1153946042 18:10018327-10018349 GTGTGATTGTGAAGGGATGCTGG + Intergenic
1155618938 18:27753643-27753665 CAGTGTATGAGAAGAGAAGGAGG - Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156593965 18:38524739-38524761 CAGTTCTTCTGAAGGGAATCTGG - Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1158745222 18:60192021-60192043 TACTGATTGTGAAGAGAAGCTGG + Intergenic
1159652246 18:70990846-70990868 CAGTGTTTGTGAAAGACAGATGG + Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160680064 19:408396-408418 CAGCGTCTGGGAAGAGAAGCAGG + Exonic
1160883963 19:1336216-1336238 CAGTGTTCGTTTGGGGAAGCAGG - Intergenic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161352849 19:3803481-3803503 CAGTGTTTGGGACGGGGGGCAGG - Intergenic
1161505272 19:4640274-4640296 CAATGTTTGTCCAGGGAAGTGGG + Intronic
1163096409 19:15060754-15060776 CAGAGGCTGGGAAGGGAAGCGGG + Intergenic
1165201087 19:34145500-34145522 CAGTGTTCATGAAGGGGACCCGG + Intergenic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165643165 19:37407604-37407626 CACTGTATGTGCAGGGAAACAGG - Intergenic
1166133991 19:40764225-40764247 CAGTGTTTGTGGTGGGGAGTTGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166786227 19:45368921-45368943 CAGAGATTGAGAAGGTAAGCTGG - Exonic
1166997084 19:46724768-46724790 CAGTGGATGTGAGGGGAAGGCGG + Intronic
1168449913 19:56458355-56458377 CAGAGGATGTGAAGGGCAGCTGG + Intronic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
929000029 2:37338469-37338491 TAGTGTTTGTGAAAGGAATCAGG + Intergenic
930335922 2:50045529-50045551 CATTGTCTGTGAGGGGAAGGAGG - Intronic
930393703 2:50793410-50793432 CATGTTTAGTGAAGGGAAGCAGG + Intronic
930583957 2:53247927-53247949 CTGGGTTTGTGATGGGTAGCAGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931738714 2:65222522-65222544 CAGAGTCTGGGAAGGGAAACTGG + Intergenic
932284488 2:70520778-70520800 TAGTGTTTGGGCATGGAAGCAGG - Intronic
936942264 2:117897303-117897325 TATTGTTTCTGAAGAGAAGCTGG + Intergenic
937483352 2:122287174-122287196 CAGAGGCTGGGAAGGGAAGCAGG + Intergenic
939184262 2:138841743-138841765 CATTATTTAAGAAGGGAAGCAGG - Intergenic
942371748 2:175293191-175293213 GAGGATTTGTGAAGGGAAGATGG - Intergenic
943367252 2:186977859-186977881 GAGTGGTTGGGAGGGGAAGCTGG + Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944988015 2:205201474-205201496 CAGTGTTTGACAAGGGATACAGG + Intronic
945036978 2:205712459-205712481 CAGTGTTTGGTAAAGGAATCCGG - Intronic
946164618 2:217856420-217856442 CTGTCTGTGGGAAGGGAAGCTGG - Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
946829097 2:223709452-223709474 CAGTGTTTCTGATGAGAAGTCGG - Intergenic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
1169413741 20:5397284-5397306 CAGTGTTTGTGATGGCACCCAGG + Intergenic
1169509522 20:6248799-6248821 CATGGTTTCTGAAGAGAAGCTGG + Intergenic
1172976458 20:38909697-38909719 CACTGTTCGTGCTGGGAAGCAGG - Intronic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174588838 20:51629134-51629156 CACTGTCTGTCATGGGAAGCGGG - Intronic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1175784516 20:61704167-61704189 CAGTGTTTGAGAAGTGCAGACGG + Intronic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1179768988 21:43598832-43598854 CTGTGTTTGTGATCTGAAGCAGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1184658318 22:45953134-45953156 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658327 22:45953166-45953188 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658366 22:45953342-45953364 CGGTGGCTGTGAGGGGAAGCTGG - Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949738933 3:7207480-7207502 CAGTGTATGTGAAGGGGATAAGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951336623 3:21430678-21430700 CAGTGTGTGTCTAGAGAAGCGGG - Intronic
951606617 3:24441668-24441690 CAGTGGTCGTGTAGGCAAGCGGG - Intronic
952298794 3:32085706-32085728 CAGAGTTTGTCCAGGGTAGCTGG - Intergenic
954201442 3:49025660-49025682 CAGTGGTTGTGTAGGAGAGCAGG + Intronic
955447165 3:59024981-59025003 CACTGTTAGTGAAGGCAAACAGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
956125333 3:66005638-66005660 CAGTGTGTGTGAGTGGAAGGGGG + Intronic
957509781 3:81172404-81172426 CAGTGTTTCTGAAGGGCCTCAGG + Intergenic
960410510 3:117317808-117317830 AAATGTTAGTGAAGGGAAGAAGG + Intergenic
960641437 3:119827816-119827838 CAGAGGTTGGGAAGGGTAGCGGG + Intronic
961007958 3:123417396-123417418 CAGGGCTTGTGAGGGGAAGAGGG - Intronic
961058670 3:123810315-123810337 CCTTGATTGGGAAGGGAAGCAGG - Intronic
964213374 3:154252698-154252720 GAGTGTGTGGGAAGGGAAGTGGG + Intronic
965205971 3:165719588-165719610 AAATTTTTGTGAAGGGAAACCGG + Intergenic
965427673 3:168547233-168547255 CCATGTTTGTGAAGGGAAAGTGG + Intergenic
967407735 3:189136262-189136284 CATTGTTTCAGAAGGGAAGGTGG + Intronic
970994621 4:22251206-22251228 CAGGGATTTTGAAGGGGAGCTGG - Intergenic
973270611 4:48258902-48258924 GAGTGTATGTGTAGGGAAGTAGG - Intronic
975052919 4:69888368-69888390 GAGTGTTTGGGAAGAGAAGGAGG - Intergenic
975510459 4:75189188-75189210 CAGTGTTGGTGATGGGAACTTGG - Intergenic
976138027 4:81959996-81960018 CAGTGTTTGTAATTGGAATCAGG - Intronic
976621539 4:87133259-87133281 AAGTGTTTTTAAAGTGAAGCTGG + Intronic
977560175 4:98524633-98524655 AAGTGTGTGTCAAAGGAAGCAGG - Intronic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978576337 4:110194089-110194111 CATTGAGTGAGAAGGGAAGCTGG - Intronic
982423320 4:155223822-155223844 CAGAGTTTGTGAAGGCAAATTGG + Intergenic
983006982 4:162495185-162495207 CAGTGTTTGTCAAGGGTACAAGG + Intergenic
983872494 4:172838218-172838240 CAGTGATTGTGAAGGTGATCAGG + Intronic
983973562 4:173903737-173903759 TAGTGTTTGTTAAGTGAAGGTGG + Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984636087 4:182111292-182111314 CAGAGTGTATGAAGAGAAGCTGG - Intergenic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
989712194 5:44412567-44412589 CCTTCTTTGTGAAGGAAAGCTGG - Intergenic
990042265 5:51389326-51389348 AAGTGTTAGCCAAGGGAAGCAGG - Intronic
990842011 5:60092280-60092302 CAGACATTGGGAAGGGAAGCAGG + Intronic
991098057 5:62760248-62760270 CAGTTTATGTGAATGGGAGCAGG - Intergenic
991972679 5:72156135-72156157 CAGTGTTTCTGAAGGAGAGGAGG - Intronic
992018621 5:72600256-72600278 AGGTGTCTGTTAAGGGAAGCAGG - Intergenic
994016466 5:94972364-94972386 CAGTGATAGTGAAGGGAAAGGGG - Intronic
996493455 5:124126393-124126415 CATTGTTTGTAAAGAGAAGTTGG + Intergenic
996545600 5:124675442-124675464 AAATGTTTGTGAAGGGAATGTGG - Intronic
996839764 5:127835697-127835719 AAGTGTGTGTGAAGTGAAGAGGG + Intergenic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000976606 5:167771864-167771886 GAGGGTCTGTGAAGGGGAGCTGG - Intronic
1001071802 5:168592118-168592140 CAGTGGCTGTGAAGGTAAACAGG - Intergenic
1001756531 5:174174630-174174652 CAGAGTTTGAGAAGAGAAACTGG - Intronic
1002691503 5:181053454-181053476 CAGCTTTTCTGAAGGGAAACGGG - Exonic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1005089218 6:22038755-22038777 CAGTGGCTGTGATGGGAGGCAGG - Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006377714 6:33680721-33680743 TAGCTTTTGTGAAGGGAAGGGGG + Intronic
1006479898 6:34283689-34283711 CAGGGTTTGTGAAAGGCTGCTGG + Exonic
1006946910 6:37790799-37790821 CAGAGCTTTTGAAGGGAAGGAGG + Intergenic
1007071864 6:39043818-39043840 CAGGGTCTGAGAAGAGAAGCAGG + Intergenic
1008969904 6:57355448-57355470 CAGTGTTACTGCTGGGAAGCAGG + Intronic
1012813272 6:103988144-103988166 CAGGGTTTGTGAAGAGACCCAGG - Intergenic
1013413595 6:109904699-109904721 GAGTGTTTGGGTAGAGAAGCAGG - Intergenic
1015113517 6:129619737-129619759 AAGTGTATGTGAAGGGTACCTGG - Intronic
1015194023 6:130505601-130505623 CAGAGTCTGTGAAGGGTAGTAGG + Intergenic
1016455464 6:144225898-144225920 CAGTGTTTCAGAAGGGAAACAGG + Intergenic
1017061035 6:150485159-150485181 TAGAGTCTGGGAAGGGAAGCAGG - Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1021097981 7:16554711-16554733 CGGTGTTTGTGAAGGTAAGGGGG - Intronic
1021337433 7:19420856-19420878 CAGTGTTGGTGAAAGGAAGAAGG + Intergenic
1024985395 7:55189530-55189552 CAGTGGTGGTGAAACGAAGCTGG + Intronic
1026515959 7:71072224-71072246 CAGAATTTGTGAAAGCAAGCAGG + Intergenic
1026527251 7:71165192-71165214 CAGGGATTGGGAAGGGCAGCTGG + Intronic
1027925606 7:84458960-84458982 CAGAGGTTGAGAAGGGTAGCAGG - Intronic
1028759712 7:94482589-94482611 CAGTGTTTGTGAGGTGAGGCGGG - Intergenic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1030154945 7:106445434-106445456 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030154963 7:106445506-106445528 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030896558 7:115068377-115068399 CAGTGTTTGCCAAGGGCAGGAGG + Intergenic
1030942963 7:115678479-115678501 CAGTGGTTGTTAAGGCATGCAGG - Intergenic
1033907355 7:146221977-146221999 AAGTGTTTGTGAAAGGAAGGAGG + Intronic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1036077530 8:5518056-5518078 CAGTGCTTGAGAATGGCAGCAGG - Intergenic
1036124609 8:6051595-6051617 CTGCTTTTGGGAAGGGAAGCTGG - Intergenic
1037379495 8:18269404-18269426 AGGTGTTTGAGAAGGGAAGTGGG - Intergenic
1038385245 8:27138154-27138176 CAGGGTTAGTTAAGGGAAGGAGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040792936 8:51254590-51254612 CAGTGTTGGTGATGGGATGGTGG + Intergenic
1041761029 8:61366595-61366617 CAGTGTTGGTCAAGGCAAGTTGG + Intronic
1044006841 8:86947907-86947929 CAGAGTCTGGGAAGGGTAGCAGG - Intronic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1045312806 8:101017894-101017916 TATTGTTTGTGAAGGGAGCCTGG + Intergenic
1046801999 8:118438944-118438966 CACTGTTTGTGCAGGGAAAAGGG + Intronic
1048201643 8:132379548-132379570 AAGGGTTTGGGAAGGGAAGAGGG - Intronic
1048707532 8:137170518-137170540 CACTGTTTGTGGTGTGAAGCAGG + Intergenic
1050518849 9:6476033-6476055 CAGAGTCTGGGAAGGGAAGTGGG - Intronic
1053579683 9:39391591-39391613 CAGAGTTTGTCAAGAGAAGGAGG + Intergenic
1053844201 9:42219671-42219693 CAGAGTTTGTCAAGAGAAGGAGG + Intergenic
1054101270 9:60950400-60950422 CAGAGTTTGTCAAGAGAAGGAGG + Intergenic
1054122643 9:61225763-61225785 CAGAGTTTGTCAAGAGAAGGAGG + Intergenic
1054585081 9:66956481-66956503 CAGAGTTTGTCAAGAGAAGGAGG - Intergenic
1055370705 9:75595376-75595398 GAATGTTTGGGAAGGGATGCTGG + Intergenic
1055575162 9:77653892-77653914 CAGTCTTTTGGAAGGGAATCTGG - Intergenic
1055766350 9:79667648-79667670 AAGTGCTTGTGAAAGGAAGGTGG + Intronic
1056418948 9:86404808-86404830 AAGTGTTTGTGAAGGGAAGATGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057643847 9:96854388-96854410 CAGCGTTTGTGCCCGGAAGCGGG - Exonic
1057815475 9:98290770-98290792 GAGTGTTAGTGAAGGGTAGCTGG + Intronic
1057832133 9:98415510-98415532 CATTTTCTGGGAAGGGAAGCTGG + Intronic
1058127811 9:101215636-101215658 CAGAGGCTGGGAAGGGAAGCAGG - Intronic
1058768282 9:108205026-108205048 CAGAGGTTGTGAAGGGTAGTAGG + Intergenic
1059170562 9:112120669-112120691 CAGACTTTGTGAAAGGTAGCAGG + Intronic
1059560006 9:115325085-115325107 AAGTGTTTGGAAAGGGGAGCTGG + Intronic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1060633616 9:125182213-125182235 CAGTGTTTGTGAGGGCAAGAGGG - Intronic
1061048582 9:128180814-128180836 CATAGTTTCTGAAAGGAAGCAGG - Exonic
1062298677 9:135850844-135850866 CCGTGTTTGTAAAGGGCAGGGGG + Intronic
1186336096 X:8590284-8590306 CAGTGTATTTGTAGGAAAGCTGG - Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1188064477 X:25641606-25641628 CAGAGTTTGAGAAGGGTAGTGGG - Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1191975195 X:66863878-66863900 CAGTGTTTGTGAAAGTGACCTGG - Intergenic
1193558160 X:82982470-82982492 CAGAGTCTGAAAAGGGAAGCTGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1194326675 X:92527109-92527131 CAGAGTCTGGGAAGGGTAGCTGG + Intronic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1196157169 X:112443080-112443102 CAGAGTTTGGGAAGGGTAGCAGG - Intergenic
1196418855 X:115502388-115502410 CATGGTTTCTGAGGGGAAGCTGG + Intergenic
1196477000 X:116099033-116099055 CAGAGGTTGGGAAGGGTAGCTGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1198362289 X:135907329-135907351 CAATGTCTGTGAAGAGAAGATGG + Exonic
1198362445 X:135908880-135908902 CAGTGTTCGTGAAGAGAAGATGG + Exonic
1200160083 X:154002610-154002632 AAGTGCTTGTGAGCGGAAGCTGG - Intergenic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1200635394 Y:5646333-5646355 CAGAGTCTGGGAAGGGTAGCCGG + Intronic