ID: 1099635802

View in Genome Browser
Species Human (GRCh38)
Location 12:85209434-85209456
Sequence ATATGGTAGTAGAAATCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099635802_1099635811 19 Left 1099635802 12:85209434-85209456 CCATCAGATTTCTACTACCATAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1099635811 12:85209476-85209498 CAATTCAAGATATTTGTGTGGGG 0: 3
1: 6
2: 15
3: 42
4: 284
1099635802_1099635806 -10 Left 1099635802 12:85209434-85209456 CCATCAGATTTCTACTACCATAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1099635806 12:85209447-85209469 ACTACCATATGTGGGGATTATGG 0: 1
1: 0
2: 14
3: 134
4: 881
1099635802_1099635807 -9 Left 1099635802 12:85209434-85209456 CCATCAGATTTCTACTACCATAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1099635807 12:85209448-85209470 CTACCATATGTGGGGATTATGGG 0: 1
1: 11
2: 115
3: 734
4: 2794
1099635802_1099635810 18 Left 1099635802 12:85209434-85209456 CCATCAGATTTCTACTACCATAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1099635810 12:85209475-85209497 ACAATTCAAGATATTTGTGTGGG 0: 3
1: 4
2: 18
3: 49
4: 430
1099635802_1099635809 17 Left 1099635802 12:85209434-85209456 CCATCAGATTTCTACTACCATAT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1099635809 12:85209474-85209496 TACAATTCAAGATATTTGTGTGG 0: 3
1: 3
2: 16
3: 78
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099635802 Original CRISPR ATATGGTAGTAGAAATCTGA TGG (reversed) Intronic
900505053 1:3025802-3025824 CTATGGTGGTAGGAATGTGATGG + Intergenic
904455517 1:30645712-30645734 ATATTGGAGCAGAGATCTGAAGG + Intergenic
905078569 1:35296473-35296495 ATATAAAAGCAGAAATCTGAGGG - Intronic
909738723 1:79000952-79000974 ATATGTTACTAAAAATCTTAGGG - Intronic
910179078 1:84461946-84461968 AAATGGAATTTGAAATCTGAAGG + Intergenic
911485027 1:98494699-98494721 ATATGCTAGTTGAAATTAGATGG + Intergenic
911888411 1:103334184-103334206 ATATTGTGGTATAGATCTGAAGG + Intergenic
912018222 1:105069940-105069962 ATAAGCAAGAAGAAATCTGAAGG - Intergenic
912603729 1:110965890-110965912 ATATGGAAACACAAATCTGATGG + Intergenic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
916306393 1:163339165-163339187 ATTTGATAGTAGAAAACTGAAGG + Intronic
918165482 1:181942507-181942529 ATTTGGTACAAGAAATCTGATGG + Intergenic
918590579 1:186236632-186236654 ATTTGGTAGTTCAACTCTGAGGG - Intergenic
920214394 1:204351545-204351567 ATATGGTGGTAAAAATCATAAGG + Intronic
921745209 1:218732722-218732744 ATATTGCAGTTGAAGTCTGAAGG + Intergenic
923421423 1:233819472-233819494 ACATGGTAGAAGAAATCAGTAGG - Intergenic
1065875314 10:29992885-29992907 ATATGTTATGAGAAATGTGAAGG - Intergenic
1069040054 10:63686272-63686294 AAATGGGGGTAGAAATCTTAAGG + Intergenic
1073624532 10:105083406-105083428 ATTTGGTCCTAGAAATGTGAAGG + Intronic
1075362401 10:121850465-121850487 ATATTGAAGTAGAATTCTCAAGG - Intronic
1075478722 10:122760316-122760338 AGATGCCAGTAGAAATCTGAAGG + Intergenic
1077791959 11:5450547-5450569 ATATGGTTTCAGAAATCTCAAGG + Intronic
1077840272 11:5966792-5966814 AGATGGTGTCAGAAATCTGATGG + Intergenic
1078498790 11:11848419-11848441 ATATGGTATTTGTAATCTTATGG + Intronic
1080082703 11:28239365-28239387 ATATGGCAGTACAATTCTGTTGG + Intronic
1080980609 11:37399831-37399853 ATATGGTATCAGAAAACTGTGGG + Intergenic
1082318609 11:50765460-50765482 ATCTGGAAGTGGATATCTGAAGG - Intergenic
1085986824 11:81798124-81798146 ATATGCTAGTAGACAACTGTTGG - Intergenic
1086169804 11:83823078-83823100 ATATGGTAATGCAAATCTAAGGG + Intronic
1086926510 11:92646391-92646413 ATATGGTAGAAGTAATGTCATGG - Intronic
1087571690 11:99935479-99935501 ATCTGATACTAGAAATTTGAGGG + Intronic
1091013755 11:132030591-132030613 ATATTTAAGTAGAGATCTGAAGG + Intronic
1093047503 12:14465589-14465611 ATAAGGTAGGAGAAATCAAAGGG + Intronic
1093532741 12:20186724-20186746 ATTTGGTAGTAGAAGACTGAGGG - Intergenic
1094214787 12:27929289-27929311 ATAGGGTAGTAGAAATTGGTTGG - Intergenic
1094764878 12:33582093-33582115 ATATAGTAATTAAAATCTGAAGG + Intergenic
1098819747 12:75212157-75212179 ATATGGCAATGGAAAACTGAGGG + Intergenic
1099047763 12:77744794-77744816 ATATGCTAATAAAAAGCTGAGGG + Intergenic
1099244605 12:80180098-80180120 ATATGAAAGTAGCAATCTGCAGG - Intergenic
1099537854 12:83866746-83866768 ATATGCTGGTAGAAAACCGAAGG - Intergenic
1099635802 12:85209434-85209456 ATATGGTAGTAGAAATCTGATGG - Intronic
1100380575 12:94057964-94057986 ATTTGGAACTAGAGATCTGAGGG + Intergenic
1100625665 12:96328816-96328838 ATATGGTAGTTGAAATTGTAGGG + Intronic
1107182641 13:37479472-37479494 CTAATGCAGTAGAAATCTGAAGG - Intergenic
1117725588 14:58669708-58669730 ATTTGGAGGTAGAAATATGATGG + Intergenic
1119894451 14:78207882-78207904 GTATGGTGGTAGAAATCTTAAGG + Intergenic
1120535142 14:85685716-85685738 ATCTTGTAGTACAGATCTGATGG + Intergenic
1123129899 14:105976639-105976661 ATATGGTGGGAGAAATTTGAAGG + Intergenic
1136001878 16:27300817-27300839 CTATGGTGGTAGAAATGAGATGG - Intergenic
1137991110 16:53156467-53156489 AAATGGTAGTAGCTGTCTGATGG - Exonic
1138781390 16:59792310-59792332 CTATGGTAGTGGAAATATTATGG + Intergenic
1139034515 16:62927363-62927385 AGATTTAAGTAGAAATCTGAAGG - Intergenic
1139556114 16:67711913-67711935 ACATGGAAGTAGAGACCTGAAGG - Intronic
1140034360 16:71361164-71361186 AGATGGCAGTGGAAGTCTGATGG - Intronic
1141685724 16:85568784-85568806 AGATGGGAGCAGAAATCAGAGGG + Intergenic
1146152293 17:30485245-30485267 ATATGGTAGTACAAATAGGAAGG + Intronic
1146375991 17:32295043-32295065 ATATGGTAGAAGCACTTTGATGG + Intronic
1147888292 17:43699126-43699148 ATAAGGGAGCAGAGATCTGAAGG - Intergenic
1149144700 17:53476309-53476331 ATACCGTAGTAGAAATCAGTGGG - Intergenic
1155076567 18:22362286-22362308 ATAAGGAAGTGGAAATTTGAAGG + Intergenic
1156063058 18:33104300-33104322 AGTTGGTAGAAGAAATCTCATGG - Intronic
1159307693 18:66666525-66666547 ATTTGCCTGTAGAAATCTGAGGG - Intergenic
1159373063 18:67554140-67554162 ATATGATTGTTGAAAACTGAAGG - Intergenic
1159505514 18:69330142-69330164 ATATCTTAGCAGACATCTGAGGG - Intergenic
1159535108 18:69705203-69705225 AAGTTGTAGTAGAGATCTGAAGG + Intronic
1160035285 18:75295782-75295804 ATCTGCAAGCAGAAATCTGATGG + Intergenic
1167814209 19:51865400-51865422 ATATGGTGTTAGAAATCTTTGGG - Intronic
926882216 2:17558411-17558433 TTAAAGTAGTAGAAATCTGGTGG + Intronic
926971347 2:18470576-18470598 ATCTGATAAAAGAAATCTGATGG - Intergenic
934691148 2:96360648-96360670 ACATTGTAGTTGAAATCTGTAGG - Exonic
936589704 2:113791708-113791730 CTATGGTAGTAAGAATTTGAGGG + Intergenic
939702732 2:145413731-145413753 AAAAGGAAGTAGAAATCTCAGGG + Intergenic
940083259 2:149828774-149828796 ATGAGGGTGTAGAAATCTGAGGG - Intergenic
940674240 2:156709278-156709300 ATATGGTAATGGAATTCAGAAGG + Intergenic
941058356 2:160814471-160814493 TTATGGTAATAGAAATAAGAAGG + Intergenic
943482242 2:188434197-188434219 TTATGGTAGAAGACAACTGAAGG - Intronic
943798735 2:192031072-192031094 ATATTTTAGTAAAAATGTGAAGG - Intronic
946838458 2:223796215-223796237 AAATGGGAGTATAAATGTGAGGG - Intronic
1170005473 20:11663758-11663780 ATGTGGCAGTTGAAATCTAATGG - Intergenic
1173054276 20:39596216-39596238 ATAGGGTTGAAGAAAACTGATGG - Intergenic
1173188773 20:40860732-40860754 AGATGGTAGGAGGAATCTCATGG - Intergenic
1177451852 21:21278903-21278925 TTATGTTAGTTGAAATCTCATGG + Intronic
1178970625 21:37173707-37173729 AGATTTTAGTAGAAATCTTAGGG + Intronic
949627235 3:5880591-5880613 AGATGGTAGTAGAAACATTATGG + Intergenic
950603817 3:14059780-14059802 AGATGGTAGTAATAATTTGAGGG + Intronic
952581658 3:34840321-34840343 ATATGATAGCAGAAATTAGAAGG + Intergenic
954424282 3:50435113-50435135 ATGTGGCAGTGTAAATCTGAGGG + Intronic
957528135 3:81404005-81404027 ATTTGGTGGTAGATATATGAGGG - Intergenic
957589520 3:82177557-82177579 AAATGGTAGAAGAAATAGGAGGG - Intergenic
958263943 3:91415130-91415152 ATTTAGGACTAGAAATCTGATGG - Intergenic
958681592 3:97338953-97338975 ATATAGTAGTAGAGATTGGATGG - Intronic
960263504 3:115594304-115594326 ATATATTAGTAGAAAAATGAAGG + Intergenic
961801454 3:129453248-129453270 ATGTGGTAGTAGGAATCTAATGG + Intronic
962444789 3:135454770-135454792 ATATAGCAGTAGAAAAATGAAGG + Intergenic
964110995 3:153087437-153087459 TTATATTAGTAGAAATCTGCAGG - Intergenic
967750768 3:193113818-193113840 ATATCCTAGGTGAAATCTGATGG + Intergenic
970416315 4:15861281-15861303 ATGTGGTAGGAGGAACCTGATGG + Intergenic
971513002 4:27450562-27450584 AGTTGGTAGTAGAAAGGTGAGGG - Intergenic
971569687 4:28195355-28195377 ATAAGGTAGTAGAATTCTCTAGG - Intergenic
973763803 4:54145398-54145420 ATATCTTGGTGGAAATCTGAAGG + Intronic
973768021 4:54181453-54181475 GTAGGGAAGTAGAGATCTGAAGG - Intronic
974656881 4:64836669-64836691 AAATGGTAGTAGAAAAATAATGG + Intergenic
976264192 4:83174717-83174739 TTATGGAAGTAGAAATCAAAAGG - Intergenic
976386905 4:84470526-84470548 CTATAGTAGTATAAATCTAAAGG + Intergenic
976571073 4:86611679-86611701 ATATGGTGGGAGAAACCAGATGG + Intronic
976962082 4:90990000-90990022 ATCTGGTTGTAAAAATCTCATGG - Intronic
978035306 4:103985810-103985832 ATATGGTATATGATATCTGAAGG - Intergenic
979707582 4:123738991-123739013 ATATTGTAGTAGGTATATGATGG - Intergenic
979889822 4:126077310-126077332 ATATGGGAGAAGCAACCTGATGG + Intergenic
982104735 4:152001729-152001751 ATGTAATAGTAAAAATCTGAAGG - Intergenic
982549288 4:156777235-156777257 GTATGGTCCTAAAAATCTGAAGG + Intronic
983434858 4:167699905-167699927 ATATTGTATTATAAATCTTAAGG + Intergenic
983747898 4:171224308-171224330 ATATGCTGGTAGAAAACTTATGG + Intergenic
984076200 4:175183550-175183572 ATATGTAATTAGGAATCTGAAGG - Intergenic
984080796 4:175247135-175247157 ATTTGGTGGTAAGAATCTGAGGG + Intergenic
985050663 4:185987886-185987908 ATTTGGAAGCAGAAATCTAAGGG + Intergenic
988338133 5:29933329-29933351 AAATGGTAGTATAAAACTGATGG - Intergenic
988633397 5:32955523-32955545 ATATGATGGTGGAAAGCTGATGG + Intergenic
988699933 5:33663251-33663273 ATATGGTAGAGGAATTCTGGGGG + Intronic
989415795 5:41173698-41173720 ATATTGAAATGGAAATCTGAAGG + Intronic
990063967 5:51689169-51689191 ATATGGTAGATGAACTATGAAGG - Intergenic
990169879 5:53036276-53036298 ATATTGTAGAAGAATTTTGAAGG - Intronic
991362483 5:65835349-65835371 ACATTGTAGTAGATATCTCATGG - Intronic
991456163 5:66806929-66806951 ATCTGGCAGTGGAACTCTGAGGG + Intronic
992337920 5:75792503-75792525 ATATGTGAGTAGAGGTCTGATGG + Intergenic
993140573 5:84027991-84028013 ATATGGTAGTAGAAATGCCCAGG - Intronic
993187562 5:84638781-84638803 ATATGAAAGTAGAAATCTCTGGG - Intergenic
993728573 5:91396419-91396441 AGAAGGTAGTCGAAATATGATGG - Intergenic
995022667 5:107383616-107383638 ATATGCTAGTAAAAATAAGATGG - Intronic
996160890 5:120162969-120162991 ATATTTTAGAAGAAATTTGATGG + Intergenic
996300159 5:121972302-121972324 TCATGGTAGTAGAAAAATGATGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998191140 5:140025646-140025668 ATATATTGGTAGAAATATGAAGG - Intronic
998824128 5:146083844-146083866 GGATGGCAGTAGAAATCTGGAGG + Intergenic
1000146217 5:158455546-158455568 TTATGGTGGTAGGAATCTCAGGG + Intergenic
1003009180 6:2410180-2410202 ATTTTGTGGGAGAAATCTGAGGG + Intergenic
1005687354 6:28267475-28267497 ATATTTGAGCAGAAATCTGAAGG + Intronic
1006247463 6:32751592-32751614 ATATGGTAGAAAAAATAAGATGG + Intergenic
1007868084 6:44996909-44996931 AGATGGTATTAGAAATCAGTGGG - Intronic
1008991491 6:57607844-57607866 ATTTAGGACTAGAAATCTGATGG + Intronic
1009621723 6:66085817-66085839 ATTTGGAAGTAGAAAACTCACGG - Intergenic
1009737007 6:67689051-67689073 ATCTTGTAGTATAAAACTGAAGG + Intergenic
1010935591 6:81857347-81857369 ATATGTGAGTTGAAATCTGGAGG - Intergenic
1012376338 6:98565937-98565959 ATATGCTACTTCAAATCTGAAGG - Intergenic
1013351708 6:109311844-109311866 GTTTGGAAGTGGAAATCTGAAGG - Intergenic
1014489337 6:122042958-122042980 ATATGTTAGCTGACATCTGAAGG + Intergenic
1014527013 6:122512868-122512890 AAATGGTAGTTTAAATCTTAAGG - Intronic
1015618928 6:135109028-135109050 ATATGGTAATTTAAATCTAAGGG - Intergenic
1015701916 6:136045746-136045768 ATGTGGTAGTAGAAATTGAAAGG + Intronic
1015868043 6:137747550-137747572 AGATGGAAGTAAAAATCTGTTGG - Intergenic
1016532223 6:145071515-145071537 AGATGTTAGAAGAAATCTGTTGG + Intergenic
1018496878 6:164357251-164357273 ATATGAAAGAAAAAATCTGAGGG - Intergenic
1022094816 7:27131964-27131986 ATTTGGTAATTGAAATTTGATGG + Intronic
1023072635 7:36451979-36452001 ATATAGTAGGACAAATCTAATGG + Intronic
1024287363 7:47770320-47770342 ATATAGAATTAGAAATCTAATGG - Intronic
1025791941 7:64696735-64696757 ATAAGCTAGTAAAAAACTGATGG - Intronic
1028145174 7:87313245-87313267 AATAGGTAGTATAAATCTGATGG - Intergenic
1030311094 7:108070102-108070124 ATATGATAGTAGAAAGATAAAGG - Intronic
1031690324 7:124780327-124780349 GTATTGTAGTTGAAATCTAAAGG - Intronic
1035333062 7:158108666-158108688 TTCTAGAAGTAGAAATCTGAAGG - Intronic
1037374458 8:18212745-18212767 AGATGGTAAAAGAGATCTGAAGG + Intronic
1037462259 8:19123117-19123139 ATATGGTGGAAGAGATCAGATGG + Intergenic
1041631337 8:60091283-60091305 AAATGGTAGTATAAATCTCAGGG + Intergenic
1043745141 8:83865936-83865958 ATATTGAAGTAGAGATCTGAAGG + Intergenic
1047380322 8:124356009-124356031 CCATTGTAGTAGAAACCTGAAGG + Intronic
1047406845 8:124592611-124592633 ATTTGGTTGTAGAAACTTGATGG - Intronic
1047794155 8:128236848-128236870 AAATGGAAGCAGAAGTCTGAAGG + Intergenic
1047906110 8:129474937-129474959 ATATTGCAGCACAAATCTGAAGG + Intergenic
1052068069 9:24047523-24047545 ATATGGAATTAGAAATATTATGG + Intergenic
1053418251 9:37960447-37960469 AAATGGAAGTTGGAATCTGAAGG + Intronic
1054874954 9:70086283-70086305 ACATTGTAGTGGAAATCGGATGG - Intronic
1056632460 9:88305090-88305112 ATATGGCATCAGAAATATGATGG - Intergenic
1059763267 9:117359603-117359625 ATATGGTTCTTGAAATCTGTGGG + Intronic
1187328197 X:18311508-18311530 ACATGTGAGCAGAAATCTGAAGG + Intronic
1190388692 X:49910648-49910670 ATATGGTGGTAGAAATTTGTGGG - Intergenic
1192032365 X:67527717-67527739 ATAGGGTTATAGAAATTTGAAGG - Intergenic
1192068506 X:67911968-67911990 ATATGAGATTAGAAATCAGAAGG - Intergenic
1192370560 X:70509390-70509412 ATAAAGTAGTAGAATTCTAAAGG + Intergenic
1192795858 X:74423336-74423358 AAATGGCAGTAGAAATATGTGGG - Intronic
1195433395 X:104814586-104814608 AAATGGTAGTGGGAATCTAAAGG - Intronic
1195496755 X:105544942-105544964 TTATGTTAGTATTAATCTGAAGG - Intronic
1195646405 X:107235632-107235654 CTGTGGTTGTAGACATCTGAAGG - Intronic
1195783751 X:108493563-108493585 ATGTGTTAGTAGAAATCATAAGG + Intronic
1197452519 X:126637716-126637738 ATGTTGCAGTTGAAATCTGAAGG - Intergenic
1198299851 X:135324852-135324874 AGATGCTAGCAGAAATCTCAGGG + Intronic
1198740784 X:139839968-139839990 TTATGGTTGTTGAGATCTGAAGG - Intronic