ID: 1099637514

View in Genome Browser
Species Human (GRCh38)
Location 12:85233292-85233314
Sequence CTAGATAAGCAGAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099637514 Original CRISPR CTAGATAAGCAGAAGGAGAA TGG Intronic
902971304 1:20053707-20053729 CTAAATCTGCAGGAGGAGAAGGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906745971 1:48222448-48222470 CCAGATGAGCAGGAGGAGAAAGG - Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
909389020 1:75096242-75096264 CTAGAAAAGGAAAAGAAGAAAGG - Intergenic
909540374 1:76784843-76784865 GTAGATTACCAGAAGGAGAGGGG + Intergenic
910349360 1:86277909-86277931 CTCCTTAAGCAGAAAGAGAAAGG + Intergenic
910507022 1:87961010-87961032 CTAGATAAGCAATAGAAGTAGGG + Intergenic
910963483 1:92785197-92785219 CGAGAAAAGGAGAAGGCGAAGGG + Intronic
911122130 1:94307117-94307139 CAAGCATAGCAGAAGGAGAAAGG - Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911544323 1:99198467-99198489 GTAGATAAGCAGAGGTAAAATGG + Intergenic
911981355 1:104571002-104571024 ATAGAAAAACAAAAGGAGAAAGG + Intergenic
913393794 1:118343828-118343850 AGAGATTAGCAGAGGGAGAAGGG + Intergenic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915290707 1:154881273-154881295 CTAGAGAAGGAAAAGGAAAAAGG + Intergenic
916160622 1:161909288-161909310 CTAGCTAGCAAGAAGGAGAAAGG + Intronic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
917262639 1:173186847-173186869 CTAGAATATAAGAAGGAGAAAGG - Exonic
917829652 1:178866923-178866945 CAAGAGTAGCAGAAGTAGAATGG + Intronic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919330239 1:196161827-196161849 GTAGATAAGGAGAATAAGAAGGG + Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
922307698 1:224358222-224358244 CTAGATATGCACAATGAGAATGG + Intronic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
923861706 1:237898279-237898301 TTAGATCAGCAGGAGCAGAATGG + Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924617662 1:245626937-245626959 CTAGATATCCATAAGCAGAAGGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063549902 10:7021518-7021540 CTACATAAGCTGAAAGATAAGGG + Intergenic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1065565542 10:27004164-27004186 CTAGAAAGACAGGAGGAGAAGGG + Intronic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1066385679 10:34939468-34939490 GTAGATAACCAGAAGTGGAAAGG + Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068757219 10:60669354-60669376 GTAGATAATCAGAAGAAGAATGG - Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1070438257 10:76414831-76414853 CTAGATAAGAACCAGGGGAATGG + Intronic
1070527407 10:77307140-77307162 CAAGATCAGCAGAAGGGGCATGG + Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071324692 10:84501428-84501450 CTAGCTGAGGAGAAGGAGAAAGG - Intronic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1071981894 10:91011777-91011799 CTAGTTGCTCAGAAGGAGAAAGG - Intergenic
1072076405 10:91978534-91978556 CTAGACAAAGAGAAAGAGAAAGG - Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1074441428 10:113480435-113480457 TTAGGTAGGAAGAAGGAGAATGG + Intergenic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1078630125 11:12995022-12995044 CTAGAGTAGTAAAAGGAGAAAGG + Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1079839064 11:25371522-25371544 ATAGAAAAGCAAAAGGAAAAGGG + Intergenic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1080889861 11:36400120-36400142 TTAAATAAGCAGAGGGAAAAAGG + Intronic
1080946549 11:36980744-36980766 CTAGAGCAGGAGAAAGAGAAGGG + Intergenic
1081440171 11:43072160-43072182 CAAGATACTCAGAAGGAGAAAGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082746833 11:56972275-56972297 CCAAATAAGCACAAGCAGAAAGG + Intergenic
1083845118 11:65327148-65327170 CTAGATAAGCCGAAGTGGGAAGG - Intergenic
1087270326 11:96104788-96104810 CTAGATTGAAAGAAGGAGAAGGG + Intronic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1087580742 11:100048666-100048688 CTAGATAAAGAGAAGTAAAATGG + Intronic
1088506764 11:110534824-110534846 CTAGGCAGGAAGAAGGAGAAAGG + Intergenic
1089649084 11:119900512-119900534 GGAGATAAGCAGGAGGAGATGGG - Intergenic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1089891938 11:121890305-121890327 TTAGATAAGCAAAGGGAAAATGG - Intergenic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1090816445 11:130301108-130301130 CTAGATAGGTAGAAGGAAATGGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091443207 12:527572-527594 CTAGATGAGCAGATGGATATGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093824696 12:23669616-23669638 CTAGATCAGCAGAAGAGTAATGG + Intronic
1094334568 12:29334220-29334242 CAAGATGAGTAAAAGGAGAATGG + Exonic
1095511867 12:42959817-42959839 GAAGATAAGCAGAAGAAGAGAGG - Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097762689 12:63486228-63486250 CTAGCTGAGGATAAGGAGAAGGG - Intergenic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099302617 12:80916805-80916827 CCAGATAAAGAGAAGAAGAAGGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100558089 12:95717740-95717762 CTAGATAAGGAGCAGGAAAATGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100994058 12:100282920-100282942 CTAGAAAAACAGAAGGATAGTGG - Intronic
1102838566 12:116092295-116092317 CCAGATAAGAAGGCGGAGAAGGG - Intronic
1103137902 12:118523558-118523580 CTAGATTTGAAGATGGAGAAAGG + Intergenic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1104252508 12:127108901-127108923 CCAGATAAAAAGGAGGAGAAGGG + Intergenic
1105841456 13:24257181-24257203 CAAGATACGTAGAAAGAGAAGGG - Intronic
1107172674 13:37361605-37361627 CAATATAAGCAAAAGGATAAAGG + Intergenic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109241263 13:59892072-59892094 ATAAGTAAGCAGAGGGAGAAGGG + Intronic
1109548674 13:63862438-63862460 CCAGATAAGCAAAAGTTGAAGGG + Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110081466 13:71319254-71319276 AAAGATAAGCAAAAGGAAAAGGG - Intergenic
1110819236 13:79895347-79895369 CCACAAAAGCGGAAGGAGAAAGG + Intergenic
1111104914 13:83632277-83632299 CTAGAAATAAAGAAGGAGAATGG + Intergenic
1111276928 13:85962150-85962172 CCAGATAAACAAAAGTAGAAGGG - Intergenic
1114173511 14:20298099-20298121 CAAGAGAAGCAAAAGAAGAAAGG + Intronic
1114248217 14:20934412-20934434 CTAGAGAAGTGGGAGGAGAAGGG - Intergenic
1114680587 14:24480855-24480877 CTTGATAAGCAGTGTGAGAATGG - Intergenic
1114975320 14:28089551-28089573 GTAGAAAATCAGAAGGAGAAAGG + Intergenic
1116608413 14:47033176-47033198 CTAATTAAGAAGCAGGAGAAAGG + Intronic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118511811 14:66483415-66483437 ATAGATAAGCAGAAGTTCAAGGG - Intergenic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1120071651 14:80110086-80110108 CTAGATCAGCAGCAACAGAACGG + Intergenic
1122332525 14:100932661-100932683 CTATACATGCAGAAGGACAAAGG - Intergenic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1126104233 15:45136814-45136836 CTACACCAGCAGCAGGAGAATGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1127007614 15:54588071-54588093 CTAGATAAGATGATAGAGAATGG + Intronic
1127082949 15:55398309-55398331 CTAGATAAGATGGAGAAGAATGG + Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130938020 15:88486535-88486557 CTACATAAACAGAAGAGGAAAGG + Intergenic
1133028088 16:2997329-2997351 CTAGCTAAGGAGAGGGCGAAGGG - Intergenic
1134262642 16:12664926-12664948 CTAGATGAGCTGAGTGAGAAAGG - Exonic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1135823087 16:25702141-25702163 TTAGAAAAACAAAAGGAGAAAGG + Intronic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1140917598 16:79508044-79508066 CTAGATTTGCAGCAGGAAAAAGG + Intergenic
1141277889 16:82604653-82604675 GTAAAAAAGCAAAAGGAGAAAGG + Intergenic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144471244 17:15543294-15543316 CTAAACCAGCAGAAAGAGAAGGG + Intronic
1144925222 17:18801399-18801421 CTAAACCAGCAGAAAGAGAAGGG - Intronic
1146013317 17:29213065-29213087 CTAGGCGAGCAGAAAGAGAATGG - Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148268012 17:46241997-46242019 TTAGAAAAGGAGAAGGAGAGTGG - Intergenic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149711857 17:58750670-58750692 CTAGTTAAGGAAAAAGAGAATGG + Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1155633298 18:27921481-27921503 CTAGCTTAGCAGAAACAGAATGG - Intergenic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157111507 18:44824819-44824841 CTAGGGAAGCAGATGAAGAAAGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158678666 18:59546884-59546906 CTAGAAAAACAGAAAAAGAATGG - Intronic
1158942842 18:62421641-62421663 ATAGATAAGAAGAAGGAGAGGGG - Intergenic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159909786 18:74134864-74134886 CTAGGTAAGGAGACGGAGAGTGG - Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161254466 19:3299678-3299700 GAAGAAAAGGAGAAGGAGAAGGG - Intergenic
1162429221 19:10617218-10617240 CAAGATAAGAAGAAGAACAAGGG - Intronic
1165935520 19:39386385-39386407 CCAGATGAGGAGCAGGAGAAGGG - Exonic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166576086 19:43839633-43839655 CTAGAGAAGCAAAAAGAAAAAGG - Intronic
1167937659 19:52921084-52921106 CTAGATCTGAAGGAGGAGAAAGG + Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
927504132 2:23602324-23602346 CAAGAAAAGCGCAAGGAGAAAGG - Intronic
928399656 2:30968801-30968823 TTAGATAAGCAGTAGAAAAAGGG + Intronic
928418929 2:31122225-31122247 CGGGATAAGCAGAACGTGAAGGG + Intronic
928854169 2:35784320-35784342 CAAGTAAAGCAGAAGTAGAATGG - Intergenic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
930109488 2:47666425-47666447 AGAAAAAAGCAGAAGGAGAAAGG + Intergenic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931553647 2:63475308-63475330 TTAGGCAAGCAGAAAGAGAAAGG - Intronic
933148610 2:78887921-78887943 AGAGATAAGCACAATGAGAAAGG + Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
933915255 2:86985256-86985278 CAAAATAAGCAGAAGAACAAGGG - Intronic
933933123 2:87175678-87175700 CTAGAAAAGCAGTAGCAGAATGG - Intergenic
934007738 2:87784645-87784667 CAAAATAAGCAGAAGAACAAGGG + Intronic
935082998 2:99817000-99817022 CTAGAGAAGGGGAAGAAGAATGG - Intronic
935394186 2:102588157-102588179 CTAGATCACTTGAAGGAGAAAGG - Intergenic
936359990 2:111789769-111789791 CTAGAAAAGCAGTAGCAGAATGG + Intronic
936824260 2:116561679-116561701 GAAGATAAGCAGAAATAGAATGG + Intergenic
938924022 2:136022917-136022939 CAAGACAAGCAGATGAAGAAAGG - Intergenic
939201385 2:139039729-139039751 TTAGGTAAGAAGAAGGAGATAGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941045328 2:160669026-160669048 CTAGATTTGCAGAAGCAAAATGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942487017 2:176450794-176450816 CAAGATAAGCAGAAGAACCATGG - Intergenic
942897158 2:181070873-181070895 CTAGATAAGCAAGAGGGGATAGG + Intronic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
944790259 2:203117640-203117662 TTAGATAAGTAAAAGGAAAAAGG + Intronic
946346221 2:219112646-219112668 CCAGATATGAAGGAGGAGAAAGG + Intronic
946749995 2:222884619-222884641 ATAGAGAGGCAGAAGGAGATTGG - Intronic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947468578 2:230378390-230378412 CTAGGCAGTCAGAAGGAGAAAGG + Intronic
947480563 2:230495752-230495774 CAAGAGAAGCATAAGTAGAATGG - Intronic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
1170631622 20:18071414-18071436 CCAGAAAAGCAGGAGGACAAAGG - Intergenic
1170641929 20:18162112-18162134 CCAGAGAAGGAGAAGGAGATGGG - Exonic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1171283038 20:23917417-23917439 CTAGAAAGCCAGGAGGAGAATGG - Intergenic
1172373354 20:34414835-34414857 CTACAGAAGTAGAAGGGGAATGG - Intronic
1176923510 21:14718670-14718692 CTAGATAAGCACACTGAGAGAGG + Intergenic
1176979694 21:15366926-15366948 ATAGATAATCAGGAGAAGAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1180109507 21:45641614-45641636 TTAGAAAAGGAGGAGGAGAAGGG - Intergenic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1182389055 22:29975048-29975070 ATAGATTAGCACTAGGAGAATGG + Intronic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184290953 22:43498008-43498030 GCAGGTAAGCAGAAGGAGAGAGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185270507 22:49927521-49927543 GTAGGTAATCAGGAGGAGAACGG + Exonic
949134273 3:543750-543772 CAAGATAAACAGAAACAGAATGG - Intergenic
949751351 3:7355878-7355900 CTAGATCAGCTGACAGAGAAAGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
953854811 3:46493134-46493156 AAAGATAAGCAGAGGTAGAATGG - Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955301671 3:57785967-57785989 CTAGAAAAGTAGTAGTAGAAGGG - Intronic
955417961 3:58710341-58710363 TTAGATATTCAGAAGGGGAAAGG + Intergenic
955740480 3:62085711-62085733 TTAGAAAATCTGAAGGAGAAAGG - Intronic
956516368 3:70052920-70052942 CAAGAGAAGCAGAAAGAAAAGGG - Intergenic
956752082 3:72351477-72351499 CAAGTTAAGCAAAAAGAGAAAGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
958529199 3:95303801-95303823 CTAGATAAAGAGAAAAAGAATGG - Intergenic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959671841 3:108987432-108987454 ATAGATAAGAAGATGGGGAAAGG + Intronic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961134972 3:124501890-124501912 ATAGAAAACCAGAAGGAGAAAGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964326804 3:155555743-155555765 TTAGGTAAGCAAAATGAGAAGGG - Intronic
964778124 3:160303042-160303064 ATAGAAAACCAGAAGAAGAATGG - Intronic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
966333219 3:178839362-178839384 CTAGATAAGAAAGAGGAGAAAGG + Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968751690 4:2393232-2393254 CTAGAAAAGGAAAAGGTGAATGG - Intronic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970839678 4:20452745-20452767 CTTGATGGGCAGAAGGAAAATGG - Intronic
971040114 4:22742563-22742585 CTAAATACCCAGAAGCAGAATGG + Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971465702 4:26957751-26957773 CTAGATGTGCAGAAGGGGAGGGG - Intronic
971586005 4:28406729-28406751 CTAGAAAAGTAGGAGGAGATGGG + Intergenic
972163326 4:36252121-36252143 CTAGATGAGGAGAAAGAGTAGGG + Intergenic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
978605354 4:110473656-110473678 CCAGATGAGCAGAGGTAGAAGGG - Intronic
979233721 4:118375661-118375683 ATAGGAAAGAAGAAGGAGAATGG - Intergenic
979323246 4:119349073-119349095 CTAGTTAGGAAGAAGAAGAAAGG + Intergenic
979413998 4:120413835-120413857 ATAATTAAGCAGAAGTAGAAGGG + Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
979955370 4:126947652-126947674 CTAGATCAGCAGAAGTATAGAGG - Intergenic
980145357 4:128976817-128976839 CAAGATAAGCACAAGCATAAAGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981960517 4:150532211-150532233 CTAGATGAGTACAAGGATAATGG - Intronic
982260823 4:153492907-153492929 CTTGATAAGGAGTAGGGGAAAGG + Intronic
982441813 4:155444297-155444319 ATAGGTAGGCAGAATGAGAATGG - Intergenic
982649172 4:158065136-158065158 TTAGATGAGCAGAAAGATAATGG + Intergenic
982861064 4:160449751-160449773 ATAGTTAATTAGAAGGAGAATGG + Intergenic
982891293 4:160854707-160854729 ATAGTTAAACAGAAGAAGAATGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986394573 5:7315759-7315781 CTAGATAGGCAACAGGAGAAGGG + Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
988950668 5:36256341-36256363 AGAGAAAAGCAGATGGAGAAAGG + Intronic
989232753 5:39104548-39104570 GCAGAAAAGGAGAAGGAGAATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990219700 5:53574256-53574278 TTAGCAAAGCAGAAGCAGAAGGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991166477 5:63569360-63569382 CTAGAACAGGAGAAGGGGAAGGG - Intergenic
991293868 5:65060805-65060827 CTAAATAAGCAGAATGGTAAGGG + Intergenic
992116606 5:73544372-73544394 CTAGAATGGCACAAGGAGAATGG + Intergenic
993225114 5:85159777-85159799 CCAGACAAGCAGAAGCAGTAAGG - Intergenic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
994867542 5:105295986-105296008 CTAGATAAACACAATGACAAAGG + Intergenic
995120264 5:108529011-108529033 CAAGATAAAAAGAAGGGGAAAGG + Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
995736198 5:115302643-115302665 CTAGACAGGAAGAAGGAAAAGGG + Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
998006415 5:138659858-138659880 TGAGAAAAGGAGAAGGAGAAAGG - Intronic
998416096 5:141947050-141947072 ATAGATAAACAAAAAGAGAATGG - Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998767012 5:145499575-145499597 CCAGAGAAGCCGAAGGAGAGAGG + Intronic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
998893185 5:146768533-146768555 CAAAATAAGCAGGAGGTGAATGG - Intronic
999441966 5:151608568-151608590 GTAGATATGCAGGAGTAGAATGG + Intergenic
1004280679 6:14276998-14277020 AAAGATGAGCAGGAGGAGAAGGG - Intergenic
1004881739 6:20015323-20015345 CTATATAAGCAGAAATAAAAAGG - Intergenic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1007930046 6:45682521-45682543 CCAGAAAGGAAGAAGGAGAAGGG - Intergenic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1008784289 6:55146806-55146828 CTAGATAAGCAGAAACATCATGG - Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1010908006 6:81516842-81516864 ATAGAGAAGGAAAAGGAGAATGG + Intronic
1012931343 6:105320525-105320547 CCAGCCAAGGAGAAGGAGAAGGG - Intronic
1014104158 6:117544520-117544542 CTTGATAGGAAGAAGAAGAAAGG + Exonic
1014133606 6:117863273-117863295 CTTGATTAGCAGTATGAGAATGG + Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014563850 6:122924406-122924428 CTAGATATGCATTAGGAGTATGG + Intergenic
1014909718 6:127077100-127077122 ATAGTTGATCAGAAGGAGAAGGG + Intergenic
1015507381 6:134003255-134003277 CTAGAAAAGCAGAGAGAGACAGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016374718 6:143408765-143408787 CTAGTTACACATAAGGAGAAGGG + Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022285392 7:28952192-28952214 CTAGAAAAAGAGGAGGAGAAGGG + Intergenic
1022837228 7:34129899-34129921 CTAGATCAGCAGTTGGAGGAAGG - Intronic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1024551247 7:50564241-50564263 CCAGATAAGCACAGGGAGCAAGG + Intronic
1026154605 7:67816188-67816210 CTAGCTAAGGAGAACGAGACAGG + Intergenic
1026404871 7:70054909-70054931 AGAGATAAGGAGGAGGAGAAGGG - Intronic
1027203712 7:76080435-76080457 CTAGTGGAGCAGAAGGAGAGAGG - Intergenic
1027404632 7:77846652-77846674 CGAGATAGGCAGGAAGAGAAGGG - Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028089186 7:86676420-86676442 GTAGAAAAGCAGCAGGATAATGG + Intronic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029912594 7:104170475-104170497 CTAGCTTAGAAGATGGAGAATGG + Intronic
1030324183 7:108202704-108202726 TAAGATAAGCACCAGGAGAATGG - Intronic
1030526801 7:110664275-110664297 CTAGATGAGCAGCAGGAGTTAGG + Intronic
1030739793 7:113095139-113095161 CTAGATCAGATAAAGGAGAAAGG - Intergenic
1032300468 7:130681742-130681764 CTAGGTCAGCAGAAAGGGAATGG - Intronic
1033439565 7:141366702-141366724 GAAGAAAAGCAGAAGGAAAATGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033772057 7:144563873-144563895 CTAAATAATCTCAAGGAGAAGGG - Intronic
1034309662 7:150075846-150075868 CGAGAAAAGTAGGAGGAGAAAGG + Intergenic
1034797195 7:154024795-154024817 CGAGAAAAGTAGGAGGAGAAAGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036394179 8:8352843-8352865 ATACATAAGCTGAAGGTGAAGGG + Intronic
1036406024 8:8455900-8455922 CTAGAAAAGCAGAGCAAGAAAGG - Intergenic
1038489136 8:27957149-27957171 CTATTTAAGCAAAAAGAGAAAGG - Intronic
1038900600 8:31839484-31839506 CTAGTTATGGAAAAGGAGAATGG + Intronic
1039221427 8:35335285-35335307 CTAAATAACCAGAAATAGAATGG + Intronic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042677931 8:71343281-71343303 CTAAATCAGTTGAAGGAGAAGGG - Intronic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1043700597 8:83283436-83283458 CTAGATAAGCAAAAGTTTAAGGG - Intergenic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1046252283 8:111647973-111647995 CTAGGTAAGCAGCAGGGTAAAGG + Intergenic
1046350673 8:113006761-113006783 CTACCTTAGCAGAAGGAGACTGG + Intronic
1046536848 8:115525561-115525583 CTAAATAATCAGATTGAGAATGG - Intronic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048187827 8:132260531-132260553 CTAGATAAGAAGAGGAAGAGAGG + Intronic
1048601128 8:135919911-135919933 CTAGAGAAGCACAAAAAGAAGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1051851014 9:21508076-21508098 CTAGGAATGCAGAAGCAGAAAGG - Intergenic
1052623903 9:30949831-30949853 CTAGATAGTAAGAAGAAGAAAGG - Intergenic
1053103390 9:35390311-35390333 CTAAATAAGCTGGAGGAGAAAGG - Intronic
1053302048 9:36959186-36959208 TAAGATAAGAAGAATGAGAAGGG - Intronic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1054936695 9:70695906-70695928 GCAGATAAGCAGTAGGAGAATGG - Intronic
1055010655 9:71561430-71561452 CTACATGAGCAGAAAGAAAATGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055764237 9:79644368-79644390 CTATATTAGCAGCATGAGAACGG + Intronic
1055885171 9:81054029-81054051 CTAGATATGCATCAGTAGAATGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1058874212 9:109228875-109228897 ATAGATAATCCGAAAGAGAAAGG - Intronic
1059257963 9:112947963-112947985 CAAGAAAAGGAGAAAGAGAATGG + Intergenic
1059822180 9:117985566-117985588 CTTGATAAGCTGAGAGAGAAAGG - Intergenic
1060322996 9:122583324-122583346 CAAGAGAAGCCGAAGGAGACAGG + Intergenic
1062414802 9:136442822-136442844 CCAGATAGGCCGGAGGAGAAAGG + Intronic
1185513660 X:681852-681874 CAAGAGAGGTAGAAGGAGAAAGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1186992099 X:15080951-15080973 TTAGATAACCTGAAGGACAAAGG + Intergenic
1187411896 X:19058337-19058359 GTACACAAGCAGAAGGAGATGGG - Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187654558 X:21455968-21455990 CTAGGTAAGCAGTCTGAGAAAGG - Intronic
1187913754 X:24133919-24133941 CTAGAAAAAGAAAAGGAGAAAGG + Intergenic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1194814056 X:98421184-98421206 CTAGATAAGCAGTGGGGGAGGGG + Intergenic
1195245222 X:102989303-102989325 CTAGATAAATAGAAAGGGAAGGG - Intergenic
1195643645 X:107205452-107205474 GTAGATAAGAACAAGTAGAAGGG + Intronic
1196089151 X:111720703-111720725 CTAGGAAAGCAGAAGAAAAATGG + Intronic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic