ID: 1099641995

View in Genome Browser
Species Human (GRCh38)
Location 12:85301679-85301701
Sequence AAAACAGGGTTTGTGGAGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099641995 Original CRISPR AAAACAGGGTTTGTGGAGAC TGG (reversed) Exonic
900944111 1:5820046-5820068 TACACAAGGTGTGTGGAGACAGG + Intergenic
901047949 1:6409992-6410014 AAAAAAAAATTTGTGGAGACAGG - Intergenic
901095686 1:6677466-6677488 AAAAAATGTTTTGTAGAGACAGG + Intronic
901107127 1:6765185-6765207 AAATCAGGGAATGTGGAGAAAGG - Intergenic
902391419 1:16109299-16109321 AAAAAAAGTTTTGGGGAGACTGG - Intergenic
902913006 1:19614950-19614972 CAGCCAGAGTTTGTGGAGACGGG - Intronic
904636422 1:31884964-31884986 TAAACAGTTTTTGTAGAGACTGG - Intergenic
906580243 1:46930043-46930065 AAAACAGGATATGGGCAGACAGG + Exonic
908163293 1:61433011-61433033 AAAACAGAAGTTCTGGAGACTGG - Intronic
908335421 1:63118233-63118255 AAGATGGAGTTTGTGGAGACGGG + Intergenic
908400598 1:63769554-63769576 AAAACAGTGTTTGGGGAGCTGGG - Intergenic
908633870 1:66140191-66140213 AAAGCAGGGTTTGTTAACACGGG + Intronic
909684213 1:78328447-78328469 GAAACAGGGTTGGTGGGGGCAGG + Intronic
910091742 1:83472526-83472548 AAAAAAGGCTTCGTGGAGAACGG + Intergenic
910953051 1:92671974-92671996 AAAAAAAAATTTGTGGAGACAGG + Intronic
911645059 1:100328888-100328910 AAAACTGGGTTTAAGGATACAGG - Intergenic
912537879 1:110389177-110389199 AAAGCAGGCTTTCTGGAGAAAGG - Intronic
915028341 1:152854284-152854306 AAAACAGGCTTTGAGGTGAAGGG + Intergenic
916139361 1:161680438-161680460 AAAAAATAGTTTGTAGAGACGGG + Intergenic
916680295 1:167097989-167098011 AAAAAAAAGTTTGTAGAGACAGG - Intronic
917432447 1:174984834-174984856 AAAAAAGGCTTTATGGAGATTGG + Intronic
918327081 1:183420011-183420033 AGACCAGGGTTTATAGAGACGGG + Intergenic
918465642 1:184818864-184818886 AAAACTGGGTTTGTGGGCACTGG + Intronic
920902817 1:210128199-210128221 AAAACATTTTTTGTAGAGACTGG - Intronic
922042070 1:221906406-221906428 AAAAAATTTTTTGTGGAGACAGG - Intergenic
922213710 1:223504250-223504272 AAGACAAGGTCTCTGGAGACAGG - Intergenic
922450063 1:225729858-225729880 AAAACAACTTTTGTAGAGACAGG + Intergenic
923180499 1:231513542-231513564 AAAAAATTGTTTGTGGAGACAGG - Intergenic
923222186 1:231905446-231905468 AAAAAAAAATTTGTGGAGACGGG - Intronic
924743542 1:246812269-246812291 AAAAAACAATTTGTGGAGACTGG - Intergenic
1062801421 10:384256-384278 AAAAAAAGGTTTGTGGGGGCTGG - Intronic
1063598121 10:7455869-7455891 AAAACAGTGTCTCTGGAGATAGG + Intergenic
1064665994 10:17652147-17652169 AAAACAGGGTTTGTGGGAAAAGG - Intronic
1065123424 10:22550159-22550181 ATGACATGGTTTGTGGTGACTGG + Intronic
1066082783 10:31948784-31948806 AAAAAATGTTTTGTAGAGACAGG - Intergenic
1067042070 10:42960189-42960211 AAAAAAGTTTTTGTAGAGACAGG - Intergenic
1068904748 10:62310201-62310223 AAAATGGGGTGTGTGGAGATTGG + Intergenic
1069694691 10:70377893-70377915 AAAACACTGATTTTGGAGACAGG + Intronic
1070040683 10:72775991-72776013 AAAACTGTTTTTGTAGAGACAGG - Intronic
1070753743 10:78978837-78978859 AAAACAGTGCTTGTCGAGATGGG + Intergenic
1072426010 10:95331486-95331508 AAAAGGGGGTTTCTGGAGAAGGG - Intronic
1072519718 10:96220410-96220432 CAAACAGAATTTGTTGAGACTGG - Intronic
1072769415 10:98125083-98125105 AAAAAATGGTTTCTTGAGACAGG - Intergenic
1072961164 10:99930557-99930579 GAAAAAGGGATTGTGGATACTGG - Intronic
1074588576 10:114791258-114791280 AAAAAATTGTTTGTAGAGACAGG + Intergenic
1075427873 10:122355970-122355992 AAAACTGGGGTTGTGCAGGCAGG + Intergenic
1075517563 10:123120680-123120702 TAAAAAATGTTTGTGGAGACAGG - Intergenic
1076118055 10:127914367-127914389 AATACAGGCTTTGCGGACACCGG + Intronic
1077598799 11:3557948-3557970 CAAAGAGGGTTTGGGAAGACTGG - Intergenic
1078292887 11:10032278-10032300 AAATCAGGGTTTGTTGACAGTGG - Intronic
1078672892 11:13380669-13380691 TAAACAGTGTTTGTGGAGAAGGG + Intronic
1078729209 11:13960679-13960701 AAAATAAGCTTTGTGAAGACAGG + Intergenic
1079036831 11:17027245-17027267 AAAACATTTTTTGTAGAGACAGG - Intergenic
1079184554 11:18224700-18224722 AGTACAGTGTTTGTGGAGACTGG + Intronic
1081343226 11:41952666-41952688 GAGACTGGGGTTGTGGAGACTGG + Intergenic
1083109906 11:60396067-60396089 AAAACATAGATTTTGGAGACAGG + Intronic
1083248953 11:61452496-61452518 AAAAAAAGTTTTGTAGAGACAGG + Intronic
1083693274 11:64424778-64424800 TAAGCAGGATTTGTGGACACAGG + Intergenic
1083705935 11:64515639-64515661 AAAACATTATTTGTAGAGACAGG + Intergenic
1086163940 11:83755530-83755552 AAAACAGTGTTTTTTGAGTCTGG - Intronic
1086809707 11:91293279-91293301 AAAACAGGGTTTTTGGTAAGAGG - Intergenic
1087850268 11:103019748-103019770 AGAAGAGGGTTTGTGGGGAGGGG + Intergenic
1089618671 11:119709734-119709756 AACTCCGGGTTTGTGGAGAGAGG + Intronic
1091682952 12:2540053-2540075 CACACAGGGTTGGTGTAGACTGG - Intronic
1091883012 12:3994900-3994922 AAAACAATGTTGGTGGAGAAAGG + Intergenic
1092019724 12:5191320-5191342 AACACAGTGATTGTGGAGCCAGG + Intergenic
1092069345 12:5620240-5620262 AAAACAGTATTAGTGGAGAAAGG + Intronic
1095134869 12:38588205-38588227 AAAAGAGTGATTGTGGAGTCAGG + Intergenic
1096205356 12:49717004-49717026 AAAAAAAGGTTTGTAGATACAGG + Intronic
1097876550 12:64648979-64649001 AAAAAATGTTTTGTAGAGACAGG + Intronic
1097942455 12:65326510-65326532 AAAAAAGGGTTTCAGGATACTGG + Intronic
1098320498 12:69239323-69239345 AAAAGACGGTGTGTGGAAACAGG + Intergenic
1099641995 12:85301679-85301701 AAAACAGGGTTTGTGGAGACTGG - Exonic
1101388264 12:104277074-104277096 AAAAAATGTTTTGTAGAGACAGG - Intronic
1101614972 12:106327366-106327388 AAAACATTTTTTGTAGAGACGGG + Intronic
1101672963 12:106893847-106893869 AAAAAATATTTTGTGGAGACAGG - Intergenic
1101997110 12:109533434-109533456 AAAGCAGGGTCAGTGGGGACGGG - Intronic
1102476906 12:113194650-113194672 AAAAAAGGGTAGGTAGAGACAGG - Intergenic
1102594087 12:113979117-113979139 AAAACAAGTTTTGTAGAGATGGG + Intergenic
1102957956 12:117071702-117071724 CAAACAGGGTTTGGGGTGGCAGG + Intronic
1103593397 12:122008143-122008165 AAAAAATGTTTTGTAGAGACGGG - Intergenic
1105393054 13:19999972-19999994 AAAATATTTTTTGTGGAGACAGG + Intronic
1106010448 13:25815964-25815986 AAAACAGGGACTGTGGGGAGAGG + Intronic
1106361522 13:29035645-29035667 AAAACAGGGATTGAGGAGCAAGG - Intronic
1106638509 13:31557890-31557912 AAAAAAGTTTTTGTAGAGACAGG - Intergenic
1106974530 13:35191871-35191893 AAAACAGGATTTTTGGAGGAAGG + Intronic
1107844369 13:44496362-44496384 TAAAAAAGTTTTGTGGAGACAGG - Intronic
1107888233 13:44892119-44892141 AGAACTGGGTTTGTAGAGGCTGG + Intergenic
1109078871 13:57872231-57872253 AAAAATGGGTTTGTGAAAACAGG + Intergenic
1110637158 13:77779423-77779445 AAAACAGTCTTAATGGAGACAGG + Intergenic
1112047292 13:95610941-95610963 GAAACAAGGTTTCTGGAGGCTGG - Intronic
1112748198 13:102551830-102551852 AAAACATGGTCTTGGGAGACAGG - Intergenic
1113034333 13:106032262-106032284 AAAACTTGGTTTGTTGAGCCTGG - Intergenic
1113526621 13:110984164-110984186 CAAACAGGGTGTGTGGAGGGAGG - Intergenic
1113651967 13:112039879-112039901 AAACCAGGAGTTATGGAGACTGG - Intergenic
1113977568 13:114240527-114240549 AAAAAATGTTTTGTAGAGACAGG + Intronic
1115554598 14:34534827-34534849 AAAAAAAAATTTGTGGAGACAGG - Intronic
1115622715 14:35156097-35156119 AAAGCAGGGGTTGTGCACACTGG - Intronic
1115879374 14:37897849-37897871 AAAACAGGGTTTAAGAAGGCAGG + Intronic
1116290902 14:43038796-43038818 AAAAAAAGATTTGTAGAGACAGG + Intergenic
1116342290 14:43739296-43739318 AAACCAGTGTTTGAGGAGGCCGG - Intergenic
1116437273 14:44909635-44909657 AAAAAATTTTTTGTGGAGACAGG + Intergenic
1117076140 14:52106701-52106723 AAAGCAGGGTTTGGGGAGGTGGG + Intergenic
1117252297 14:53950140-53950162 ACAACAGGCTTTGGGGATACTGG + Exonic
1117467011 14:56003823-56003845 AAAACACTTTTTGTGGAGATGGG + Intergenic
1117972959 14:61270295-61270317 TAAAAAATGTTTGTGGAGACAGG - Intronic
1117974388 14:61282892-61282914 AAAAAAGGGTGACTGGAGACTGG - Intronic
1118313604 14:64710297-64710319 TAAACAGGGTCTGAGAAGACTGG - Intronic
1118379386 14:65205143-65205165 AGAACATGGGCTGTGGAGACAGG + Intergenic
1118546212 14:66892245-66892267 TAAACAAGTTTTGTAGAGACAGG - Intronic
1118788806 14:69069788-69069810 AAAAAAAAGTTTGTGAAGACAGG + Intronic
1119992381 14:79213600-79213622 AAAAAAGGGTGAGAGGAGACAGG - Intronic
1120905854 14:89620691-89620713 AAAACAGGGCTTGTTGAAAGCGG - Intergenic
1121034045 14:90684217-90684239 AAAACAGCTATTGTGGATACTGG - Intronic
1121451281 14:94009734-94009756 AAAACAGGGGTGGTGGTGAGAGG + Intergenic
1121526165 14:94620973-94620995 AAAACAGGGGTGGTGGGGAAAGG - Intronic
1121769921 14:96524693-96524715 AAAACATTTTTTGTAGAGACGGG + Intronic
1121832250 14:97062629-97062651 AACACAGGGATTTTGGAGAGGGG - Intergenic
1122214031 14:100192032-100192054 AAAACAAAGTTTCTGGAAACAGG - Intergenic
1123204128 14:106695241-106695263 ACAACAGGGATTGTGGTGGCTGG - Intergenic
1123209138 14:106741709-106741731 ACAACAGGGATTGTGGTGGCTGG - Intergenic
1123980839 15:25601072-25601094 AAAACAGTATTTGTAGAGATAGG - Intergenic
1124147137 15:27138401-27138423 AAAACAGAGTTTGATGAGAAAGG - Intronic
1125580058 15:40778926-40778948 AGAACATGGTTTTTTGAGACAGG - Intronic
1125592399 15:40863028-40863050 AAGACAGAGCTTCTGGAGACCGG + Intergenic
1125748188 15:42011548-42011570 AAAAAATTATTTGTGGAGACAGG - Intronic
1125953788 15:43775993-43776015 AAGAAAGGGTTTGTGGAAAGTGG - Intronic
1126604390 15:50460983-50461005 AAAAAAAAGTTTGTAGAGACAGG - Intronic
1127015369 15:54679417-54679439 AAAACAGTCTTTGAGGACACAGG + Intergenic
1127967150 15:63930885-63930907 AAAAAATGTTTTGTGGAGATGGG - Intronic
1128069685 15:64787140-64787162 CAACCAGGGTTTGAGGTGACAGG - Intergenic
1130317027 15:82804910-82804932 AAATCAGGATTTGGGGAGAAAGG + Intronic
1130761754 15:86828111-86828133 AAAAAATTGTTTGTAGAGACGGG + Intronic
1131731398 15:95285646-95285668 AAAACAGGGTCTGTGGAACTAGG - Intergenic
1132664760 16:1076295-1076317 AAGACAGGGTGTGGGGAGAGAGG - Intergenic
1132795754 16:1721427-1721449 AAAAAAGGTTTTGTAGAGATAGG - Intronic
1133373303 16:5262737-5262759 CAAAGAGGGTTTGGGAAGACTGG + Intergenic
1133792395 16:9019098-9019120 AAAAAACGTTTTGTAGAGACGGG - Intergenic
1133921658 16:10159019-10159041 AAAACAGAGGTTGTGGAGTCAGG + Intronic
1134112845 16:11526376-11526398 AAAATATTTTTTGTGGAGACGGG - Intergenic
1134347670 16:13406344-13406366 AAAAAAGGGGTTGAGAAGACAGG - Intergenic
1134816044 16:17206885-17206907 AAAATAGGGGTTTTGGAGTCTGG - Intronic
1135606614 16:23831390-23831412 AAAAAAGTTTTTGTGGAGATGGG + Intergenic
1135814037 16:25615790-25615812 AAAAAAAGTTTTGTAGAGACAGG + Intergenic
1135905517 16:26508282-26508304 AAAAAAATGTTTGTGGAGATGGG + Intergenic
1136359161 16:29766721-29766743 GCAACTGGGTTTGTGGTGACAGG - Intergenic
1136624647 16:31454687-31454709 AAAAAATGTTTTGTAGAGACGGG - Intergenic
1137066819 16:35855454-35855476 AAAAGTTGGTTTCTGGAGACAGG - Intergenic
1137792085 16:51183697-51183719 AAAACATTTTTTGTTGAGACAGG - Intergenic
1138583188 16:57954918-57954940 AAAAAAGGTTTTTTAGAGACAGG + Intronic
1138615418 16:58161664-58161686 CAAAAATGGTTTTTGGAGACAGG + Intronic
1140207481 16:72945694-72945716 AAAACAAGGTTTGAGGCAACTGG + Intronic
1140220317 16:73039127-73039149 AAAAAAAAGTTTGTAGAGACAGG + Intronic
1140242032 16:73211288-73211310 AAAATAGGGTTTCTGGGCACTGG + Intergenic
1140344550 16:74200256-74200278 AAATCAGTGTTTGCGGTGACAGG + Intergenic
1141128887 16:81421050-81421072 AAAAAAGTTTTTGTAGAGACAGG + Intergenic
1141968604 16:87464311-87464333 AAATCAGAGTTTCTGGAAACGGG + Intronic
1142118953 16:88376574-88376596 AAAACAGAGGCGGTGGAGACCGG - Intergenic
1142661600 17:1433869-1433891 AAAACATTTTTTGTAGAGACCGG + Intronic
1143597653 17:7924915-7924937 AAAACATTTTTTGTAGAGACAGG + Intronic
1145270103 17:21400296-21400318 AAGGCAGGGTGTGAGGAGACAGG - Intronic
1145308325 17:21687747-21687769 AAGGCAGGGTGTGAGGAGACAGG - Intergenic
1146953128 17:36920436-36920458 AAAACAGGGTTGGGGAGGACTGG - Intergenic
1147317032 17:39626005-39626027 GAAGCAGGGTTGGGGGAGACAGG - Intergenic
1147357105 17:39906703-39906725 AAGTCAGAGTTTCTGGAGACGGG + Intronic
1147968340 17:44206287-44206309 AAAACAGAGGATGTGGAGAACGG + Exonic
1148104656 17:45112848-45112870 AAAGCAAGGTTGGTGGAGGCTGG - Exonic
1149470340 17:56911091-56911113 AAAACATTTTTTGTAGAGACGGG - Intronic
1149537536 17:57444085-57444107 AAAAAAGGGTTTGGGGTGAGGGG - Intronic
1149642614 17:58213731-58213753 AAGAAAGGGGTAGTGGAGACTGG - Intronic
1151779409 17:76233702-76233724 AAAACAATTTTTGTAGAGACAGG + Intronic
1152137907 17:78516305-78516327 AAAAAATTGTTTGTGTAGACAGG - Intronic
1153944081 18:10003541-10003563 GAGAGAGGGTTTGGGGAGACAGG - Intergenic
1154998546 18:21664801-21664823 AAAAAATGTTTTGTAGAGACAGG + Intronic
1155444121 18:25892939-25892961 GTAAAAGGGTTTGTTGAGACTGG - Intergenic
1155554893 18:27007818-27007840 AAAATAGGGTCTGGGGGGACAGG + Intronic
1155693475 18:28654885-28654907 ACACCAGGGCTTGTGGGGACTGG + Intergenic
1156344981 18:36248979-36249001 AAAGCAGGGTCTGTGCTGACAGG + Exonic
1156466585 18:37351554-37351576 AAAACTGTGTTTCTGGACACTGG - Intronic
1157093012 18:44658693-44658715 AAAACTGAGTTTTTGGAGCCGGG - Intergenic
1158154185 18:54406831-54406853 AAAACAGGCTCTATGGAGAGAGG + Intergenic
1158591236 18:58780619-58780641 AAAAAAAGTTTTGTAGAGACTGG - Intergenic
1158979691 18:62747689-62747711 AAAAAATGTTTTGTAGAGACGGG + Intronic
1159244860 18:65792721-65792743 ATAAGAGGGCTTCTGGAGACTGG - Intronic
1160620697 18:80168536-80168558 AAAACAGGATATGGGGAGAGAGG - Intronic
1161928059 19:7316243-7316265 AAGACAGGATTTGTTGAGACTGG - Intergenic
1162497791 19:11033124-11033146 AAAACAGAGCTGGTGGAGCCTGG - Intronic
1163352034 19:16783204-16783226 AAAACAGTTTTTGTAGAGACTGG + Intronic
1163789145 19:19296143-19296165 AAAAAAAGTTTTATGGAGACGGG - Intronic
1164811061 19:31156341-31156363 AAGACAAGGTATTTGGAGACTGG - Intergenic
1164886492 19:31782946-31782968 AAAAAAAAATTTGTGGAGACAGG - Intergenic
1165191993 19:34072086-34072108 AAAACAGGGGCTGTGGTGATGGG + Intergenic
1165962236 19:39544787-39544809 AAAACATGTTTTGTAGAGATGGG + Intergenic
1166232860 19:41435730-41435752 AAAACATTTTTTGTAGAGACAGG + Intronic
1167241702 19:48347539-48347561 AAAAAAAGTTTTGTAGAGACAGG - Intronic
1167326990 19:48832723-48832745 AAACCAGGGTCTGAGGAGAAAGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168191495 19:54741548-54741570 GGAACAGGGTGTGTGGACACTGG + Intronic
1168193764 19:54758176-54758198 GGAACAGGGTGTGTGGACACTGG + Intronic
1168197716 19:54787766-54787788 GGAACAGGGTGTGTGGACACTGG + Intronic
1168204188 19:54837145-54837167 GGAACAGGGTGTGTGGACACTGG + Intronic
924971764 2:134454-134476 AAAATAGGGTTTCTGGGTACTGG + Intergenic
925085634 2:1105533-1105555 AAAACAGATTTTTTGGAGAGCGG - Intronic
925992116 2:9262018-9262040 AAAACAATGTTTTTAGAGACAGG + Intronic
927099265 2:19775449-19775471 ACAGCAGGGTTGCTGGAGACAGG - Intergenic
928526145 2:32143091-32143113 AAAAAAGTTTTTGTAGAGACAGG - Intronic
928934989 2:36666770-36666792 AAAAAATTGTTTGTAGAGACAGG + Intergenic
929124638 2:38512107-38512129 AAAAAAAAGTTTGTAGAGACAGG + Intergenic
929305554 2:40357318-40357340 AAAAAATGTTTTGTAGAGACAGG - Intronic
931003993 2:57827607-57827629 AAAATAGCGTTTTTGGAGGCTGG + Intergenic
931545040 2:63373425-63373447 AAAAAACGTTTTGTAGAGACGGG + Intronic
932205862 2:69882103-69882125 AAAATAGGGTTACTGGAGGCTGG + Intergenic
932691655 2:73918761-73918783 AAAACAGGGTTTGGGTAGACTGG + Intronic
932774406 2:74518913-74518935 AAAACATGATCTGAGGAGACAGG - Intronic
932795253 2:74689363-74689385 AAACAAGGATTTGTGGAGAGTGG + Intergenic
934166048 2:89295340-89295362 AAATCAGGAGCTGTGGAGACTGG + Intergenic
934201228 2:89887116-89887138 AAATCAGGAGCTGTGGAGACTGG - Intergenic
934688354 2:96337915-96337937 AAAAAAGGGTTGTTGGAGTCAGG - Intronic
935195886 2:100816033-100816055 AAAACAGGGCTGGAGGAGTCTGG - Intergenic
936469631 2:112787333-112787355 AAAACGGGGGTTGCGGAGAAGGG + Intergenic
937020837 2:118653058-118653080 AAAAAAGGTTTTTTGGAGACAGG - Intergenic
938118832 2:128619957-128619979 ACAGCAGGGTGTGTGGAGATGGG - Intergenic
938644141 2:133314264-133314286 AAACCAGGGTTTCTAGAAACTGG + Intronic
940974868 2:159931356-159931378 AAAAAAACTTTTGTGGAGACGGG - Intergenic
941176039 2:162198543-162198565 GAAACAGAGTTTGGGGAAACAGG - Intronic
941914394 2:170800423-170800445 AAAACAATTTTTGTAGAGACAGG + Intergenic
942385878 2:175442253-175442275 AAAAGAGGGTTGGTGGGGAGCGG - Intergenic
942650314 2:178160078-178160100 AAGACAGAGGTTGTGGAGATTGG - Intergenic
942721468 2:178957897-178957919 AAAACATTTTTTGTAGAGACAGG + Intronic
943642812 2:190377913-190377935 AAAACATATTTTGTAGAGACAGG + Intergenic
944218715 2:197280903-197280925 AAAACAGTCTTTCTGGAGTCTGG + Intronic
945236590 2:207637044-207637066 AAAACAGTGTCTGTGAAGGCTGG - Intergenic
947740367 2:232482086-232482108 GAAACAGGGCTGGAGGAGACAGG + Intronic
1169099674 20:2936028-2936050 AAAAAATCGTTTGTAGAGACAGG + Intronic
1171340476 20:24423161-24423183 AAAAAATGGTTTGTAGGGACAGG - Intergenic
1173137112 20:40448098-40448120 AACACAGCCTTTGTGGAGCCTGG + Intergenic
1173285330 20:41666203-41666225 AAAACATGTTTTGTAGAGACAGG + Intergenic
1173554250 20:43954333-43954355 AACACAGGAAGTGTGGAGACAGG - Intronic
1173714419 20:45189906-45189928 AAAACAGTTTTTGCTGAGACTGG + Intergenic
1173957334 20:47044006-47044028 AAATCTGTGTTTTTGGAGACAGG + Intronic
1174308173 20:49629969-49629991 AAAACAGGGTAAGGGGGGACAGG + Intergenic
1174747778 20:53081019-53081041 AAAACATGTTTTTTAGAGACAGG + Intronic
1174752689 20:53127532-53127554 AAAAAAGTTTTTTTGGAGACAGG - Intronic
1175182001 20:57155280-57155302 TGAACAGGGGTTGTGGGGACTGG + Intergenic
1175672931 20:60921457-60921479 AGAACATGGTTTGTGGAGAGTGG - Intergenic
1176148568 20:63576749-63576771 AAAACAGTGCTTCAGGAGACAGG - Intergenic
1176193076 20:63822840-63822862 AAAACATGTTTTGTACAGACAGG - Intronic
1176200865 20:63859783-63859805 AAAACAGGGTATATCTAGACCGG + Intergenic
1177798233 21:25801371-25801393 AAATTAGGGTCTGTGTAGACTGG + Intergenic
1178275159 21:31230382-31230404 AGAACAGGGTTGGTGGAGATTGG - Intronic
1180605224 22:17053670-17053692 AAAACATTTTTTGTAGAGACAGG - Intergenic
1181526994 22:23495731-23495753 AAAAAATGTTTTGTAGAGACAGG + Intergenic
1181968356 22:26672189-26672211 AAAACAGGGTTAGTAGGGGCTGG - Intergenic
1182809990 22:33107691-33107713 AAAACATTTTTTGTAGAGACAGG - Intergenic
1183596303 22:38814455-38814477 AAAAAAAATTTTGTGGAGACAGG + Intergenic
1183909688 22:41069167-41069189 AAAACAGCATTTGTGGAGGAGGG - Intergenic
1184456300 22:44611647-44611669 ATGACAGGGGTGGTGGAGACAGG + Intergenic
1184565791 22:45291104-45291126 AAGACAGGTTTTCTGCAGACGGG - Intronic
1184590904 22:45482558-45482580 AAAAGAGTGTTTGTGTGGACTGG - Intergenic
1184922895 22:47618266-47618288 ACAACAGGGTCTAGGGAGACAGG - Intergenic
949127172 3:460137-460159 AAAAAAGGCTTTGTGGAAAACGG - Intergenic
950308358 3:11934367-11934389 AACTCAGGGTTTCTGGAGAGAGG - Intergenic
950430905 3:12950493-12950515 AAAAAATGTTTTGTGGAGACAGG - Intronic
950751659 3:15133905-15133927 CAAAGAGGGTTTGGGAAGACTGG + Intergenic
951605521 3:24429884-24429906 GATGCAGGGTTTGGGGAGACAGG + Intronic
952400745 3:32961017-32961039 ACAACGGGGATTTTGGAGACAGG - Intergenic
952984298 3:38763862-38763884 AAATCAGTGTCTGAGGAGACTGG - Intronic
954159442 3:48710213-48710235 AAAACATTTTTTGTGAAGACAGG - Intronic
954600452 3:51863525-51863547 AAAACAGGGTCCTTGGACACAGG - Intergenic
955117583 3:56020962-56020984 GAAATAGGGATGGTGGAGACTGG + Intronic
955470036 3:59277043-59277065 AGAAGAGGGCTTGTGGAGACAGG + Intergenic
956113748 3:65897685-65897707 AAAAAAAATTTTGTGGAGACAGG - Intronic
956969531 3:74506442-74506464 AAAACAGGGTGGGAGGAGATGGG + Intronic
960967075 3:123112853-123112875 AAAACAGGGCTTGGGGGGCCGGG - Intronic
962051164 3:131817184-131817206 AAAGCAGGGTTGGGGGAAACTGG + Intronic
962325378 3:134427981-134428003 ACTACAGGGTGTGTGAAGACAGG - Intergenic
963815378 3:149825166-149825188 AAAAAAGGGTTGCTGGAGCCTGG - Intronic
964865005 3:161247955-161247977 AAAACACGTTTTGTAGAGACGGG + Intronic
965095073 3:164215855-164215877 AAAAGTTGGTTTCTGGAGACAGG + Intergenic
967636171 3:191805150-191805172 AAGTCTGGGTTTGTGGGGACTGG - Intergenic
967760079 3:193214045-193214067 AGAACATGGTTTCTGGAGCCAGG - Intergenic
969740565 4:9022862-9022884 CAAAGAGGGTTTGGGAAGACTGG + Intergenic
969799909 4:9555691-9555713 CAAAGAGGGTTTGGGAAGACTGG + Intergenic
969931551 4:10635830-10635852 AGAACACGGATTTTGGAGACAGG - Intronic
970326787 4:14933906-14933928 AAAACATGGTCTTTAGAGACAGG - Intergenic
970336891 4:15056585-15056607 AGAACAAGGTTTGGGGATACTGG - Intronic
972857459 4:43124188-43124210 AAAACAGGTATTGTGGATGCAGG + Intergenic
974580797 4:63798510-63798532 AAGACAGTGTTTGTGGTGGCTGG - Intergenic
975980422 4:80151927-80151949 AAAATAGAGATTTTGGAGACTGG - Intergenic
976308240 4:83582920-83582942 AAAACAGGGTTCGTGTACTCTGG + Intronic
976720132 4:88161140-88161162 AAAAAATTGTTTGTAGAGACAGG - Intronic
978518679 4:109596331-109596353 AAAACAGGGTCCTTGGACACAGG + Intronic
979566333 4:122157943-122157965 AAAACAGGGACTTGGGAGACAGG - Intronic
979578156 4:122320320-122320342 AAAACATTTTTTGTGGGGACAGG + Intronic
980290296 4:130841449-130841471 AAAACAGGGTTTGCGGGGGTGGG + Intergenic
980609071 4:135132906-135132928 AAAACAGTGTTTGTCAAGGCCGG - Intergenic
981531330 4:145756403-145756425 AAAACATGGTGTGTGGACCCCGG - Intronic
981919973 4:150077065-150077087 AAATCAGAATTTCTGGAGACGGG - Intergenic
981951346 4:150411712-150411734 AAAACAGGGATTGTGCTGTCTGG + Intronic
982150414 4:152449033-152449055 TGAACAGTGTGTGTGGAGACGGG - Intronic
985080137 4:186256406-186256428 AGAACATGGTTTTGGGAGACGGG - Intronic
985690341 5:1306337-1306359 AAAAAAAAGTTTGTAGAGACAGG + Intergenic
986701037 5:10408990-10409012 AAAAAATATTTTGTGGAGACAGG + Intronic
987542275 5:19271025-19271047 TAATAAGGGGTTGTGGAGACTGG + Intergenic
987650622 5:20735667-20735689 AAAATAGGTTTTGTGGAGAATGG - Intergenic
989004534 5:36795725-36795747 AAAACATTTTTTGTAGAGACAGG - Intergenic
989156950 5:38353347-38353369 AAAACAATGTTTGTGGAGTTGGG + Intronic
989384279 5:40838863-40838885 AAAAAAAATTTTGTGGAGACAGG - Intergenic
989834544 5:45970361-45970383 AAAACAGTTTTTGTGGACTCTGG + Intergenic
989984493 5:50681833-50681855 AGAACAGGGTGTAGGGAGACAGG - Intronic
992910058 5:81387714-81387736 AAAATATTTTTTGTGGAGACAGG + Intronic
996468639 5:123833468-123833490 ACAAAAGAGTGTGTGGAGACAGG + Intergenic
998669539 5:144338313-144338335 AGAACATGGATTTTGGAGACTGG + Intronic
1002070297 5:176675143-176675165 AAAAAAGGTTTTGTGGGGCCGGG + Intergenic
1002991255 6:2241112-2241134 ACAGCATGGTTTGGGGAGACAGG + Intronic
1003605707 6:7558683-7558705 AAAAAATTTTTTGTGGAGACAGG + Intronic
1003694846 6:8394180-8394202 AAAACAGGCTCTGTGGGGAGGGG - Intergenic
1003934094 6:10957639-10957661 AAAACATTTTTTGTAGAGACAGG - Intronic
1004077530 6:12358174-12358196 AAAAAAGAATTTGTAGAGACGGG + Intergenic
1004633764 6:17447186-17447208 AAAAAAAAGTTTGTAGAGACAGG + Intronic
1004678634 6:17869932-17869954 AAAACAGGGGAAGTGGAGAAGGG - Intronic
1006089802 6:31621424-31621446 AAAACGGGGTTGGGGGAGAAAGG - Intronic
1006426441 6:33966215-33966237 AAAACATTATTTGTAGAGACAGG + Intergenic
1007856347 6:44862281-44862303 CAAAAAGGCTTTGTGGAGAAAGG - Intronic
1008002806 6:46378019-46378041 ATGACAGGGCTTGTGGATACAGG - Intronic
1008574730 6:52849216-52849238 GAAACAGGGAATGTGGAGAAAGG - Intronic
1009888360 6:69652004-69652026 CAATGAGGGTTTGTGGAGACTGG - Intergenic
1010085705 6:71915517-71915539 GAAACAGAGTTTGTGGAGCAAGG - Intronic
1010626393 6:78140438-78140460 AAAAGTTGGTTTCTGGAGACAGG - Intergenic
1010921744 6:81690870-81690892 AAAACATTTTTTGTAGAGACGGG - Intronic
1011266421 6:85524251-85524273 ATAATAGGTTCTGTGGAGACTGG + Intronic
1012442973 6:99279022-99279044 AACCCATGCTTTGTGGAGACAGG + Exonic
1012772134 6:103451772-103451794 AAAACAGGTTTTGTGGATTGAGG + Intergenic
1013040378 6:106427024-106427046 AAAAGAGAGTTCATGGAGACAGG - Intergenic
1013228557 6:108139927-108139949 AAAAAATGTTTTGTAGAGACAGG - Intronic
1013528181 6:110994699-110994721 AAAGCAGACTTTGTGGAGAATGG + Intronic
1013817011 6:114110672-114110694 AAAGAAGGGTTTGGGGAGAGTGG + Intronic
1015042288 6:128736924-128736946 AAAACATGGTTTCTGGATAAGGG + Intergenic
1015097033 6:129428256-129428278 AAAAAATGTTTTGTAGAGACAGG - Intronic
1015334964 6:132026169-132026191 ACAACAGGGTCTGTGTAGAAAGG + Intergenic
1017073604 6:150598811-150598833 AAAACAAGGTTTGTGCAGTAAGG - Intergenic
1018046053 6:159967791-159967813 GAAAAAGGGTTTGTGGTGACCGG - Intergenic
1019488006 7:1298295-1298317 AAACCAGGGGCTGTGGGGACAGG + Intergenic
1019703789 7:2487953-2487975 AAAACAAGGGATGTGGAGACAGG + Intergenic
1020653655 7:10905023-10905045 AAAAAATGGTTAGTGAAGACTGG - Intergenic
1020991436 7:15201531-15201553 AAAACATGGTGTGTGAAGACAGG + Intronic
1022063530 7:26826061-26826083 AAAAAAGAGTTTGTGGAGAGGGG - Intronic
1022130149 7:27397457-27397479 AAAAGGGAGTATGTGGAGACAGG + Intergenic
1022224055 7:28345456-28345478 ATAACAGGGTTTGTTGTGATGGG + Intronic
1022420433 7:30215723-30215745 AAAGCACAGTTTGAGGAGACAGG + Intergenic
1022643723 7:32211848-32211870 AAAACTTTTTTTGTGGAGACAGG - Intronic
1023253514 7:38290557-38290579 AAAGCAGAGTTTGGCGAGACTGG + Intergenic
1023388908 7:39688402-39688424 AAAAAAAAGTTTGTGGAGAGTGG + Intronic
1023686606 7:42741989-42742011 AGAACAGAGTGTCTGGAGACAGG - Intergenic
1023927264 7:44678597-44678619 ACAACAAGGTTTGTGTAGACTGG - Intronic
1023967198 7:44969213-44969235 GAAACAGGGTTTGAGGATAGTGG - Intronic
1023975634 7:45027911-45027933 AAAGCAGGGGTCATGGAGACTGG - Intronic
1024267214 7:47616011-47616033 AAAAAATTGTTTGTGGAGATGGG + Intergenic
1027308595 7:76928976-76928998 AAAAAAGGCTTCGTGGAGAAGGG + Intergenic
1027394888 7:77744205-77744227 AAAAAAGATTTTGTAGAGACAGG + Intronic
1029071931 7:97906580-97906602 CAAAGAGGGTTTGGGAAGACTGG - Intergenic
1029947269 7:104545846-104545868 AAAGCAGGCTTGGTGGAGGCAGG - Intronic
1030388246 7:108892340-108892362 AAAACAGAGGTTCTGGATACTGG - Intergenic
1030970886 7:116053340-116053362 TAAATGGGGTTTGTGGAGAAAGG + Intronic
1031010599 7:116522870-116522892 TAAAAAGTGTTTGTAGAGACGGG - Intergenic
1031861625 7:126986188-126986210 AAAACATTTTTTGTAGAGACAGG + Intronic
1032157184 7:129478137-129478159 AAAACAGGCTCTTTGGAGAGGGG - Intronic
1032361036 7:131255112-131255134 AAAAAAAATTTTGTGGAGACAGG + Intronic
1033129800 7:138735885-138735907 AAAAAAGCTTTTGTAGAGACGGG - Intronic
1033190193 7:139270954-139270976 GAGACAGGGTTGGTAGAGACAGG + Intronic
1033410308 7:141111434-141111456 AATACAGGCACTGTGGAGACTGG + Intronic
1034489096 7:151383486-151383508 AAAAAAATGTTTGTAGAGACAGG + Intronic
1035013830 7:155745535-155745557 CAAACAGTGGTGGTGGAGACGGG + Exonic
1036245764 8:7115422-7115444 CAAAGAGGGTTTGGGAAGACTGG + Intergenic
1036255023 8:7199046-7199068 CAAAGAGGGTTTGGGAAGACGGG - Intergenic
1036362465 8:8088461-8088483 CAAAGAGGGTTTGGGAAGACGGG + Intergenic
1036888501 8:12578604-12578626 CAAAGAGGGTTTGGGAAGACTGG - Intergenic
1037256518 8:16961552-16961574 AAAACAGAGTTTGTGCAGTTTGG - Intergenic
1037550916 8:19970537-19970559 AAAACAGAGTGTATGGACACAGG - Intergenic
1037723659 8:21466057-21466079 TAAAGAGGGTGTGTGGGGACAGG + Intergenic
1038312403 8:26454709-26454731 AAAAAATGTTTTGTAGAGACAGG - Intronic
1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG + Intronic
1038999767 8:32966906-32966928 AAAAGAGGCTTTGAGCAGACAGG + Intergenic
1039414947 8:37385881-37385903 TAAACGGGGGTTGGGGAGACGGG - Intergenic
1040821068 8:51558234-51558256 AAATTAGAGTTTGTGGAGGCAGG - Intronic
1041677421 8:60549464-60549486 AAAAAAAGGTTGGTGGAGACGGG - Intronic
1042372023 8:68002803-68002825 AAAACAGAGTTTGTTGACCCAGG + Intronic
1042720212 8:71819350-71819372 GAAACAGGGTTTTTGTAGAAAGG + Intergenic
1043554016 8:81408965-81408987 AAAAAATGTTTTGTAGAGACAGG - Intergenic
1044852630 8:96444030-96444052 AAAACAGGGGTTTTGGGGGCTGG + Intergenic
1045971349 8:108082825-108082847 AAAACAGGGTGTGTGGGGGATGG + Intronic
1046899625 8:119509879-119509901 AAAGCAGGATTTGTTGAGTCAGG + Intergenic
1047094661 8:121611026-121611048 AAAAAATTGTTTGTAGAGACTGG + Intergenic
1047224408 8:122944170-122944192 AACACAGGGTTTGGACAGACTGG + Intronic
1049555885 8:143281803-143281825 AGAAAAAGGTTTGCGGAGACCGG + Intergenic
1050168417 9:2790588-2790610 AAAAACGGGTTTTTAGAGACTGG + Intronic
1051216082 9:14799105-14799127 AAAAAAAGTTTTGTAGAGACAGG - Intronic
1051639720 9:19213358-19213380 TAAAGAGGGTTCCTGGAGACAGG - Intergenic
1052084914 9:24253209-24253231 AAATCAGTGATTGTGAAGACAGG - Intergenic
1055013275 9:71590292-71590314 AGAACAGGCTTTGTGGAAACAGG - Intergenic
1055482071 9:76718550-76718572 AAAACAAGGTGTGTGGTGTCAGG - Intronic
1056401821 9:86235134-86235156 AAAACAGAGTTTGAAGAGACAGG + Intronic
1057296165 9:93843466-93843488 AAAACATTTTTTGTAGAGACAGG - Intergenic
1058831121 9:108817416-108817438 AAAAAATTGTTTGTAGAGACAGG + Intergenic
1059169213 9:112109620-112109642 AAAACATGGTCTTTGGAGTCAGG - Intronic
1060315296 9:122504247-122504269 AAAGCAGTGTTTCTGGAGCCAGG - Intergenic
1060461599 9:123860573-123860595 AAAATAAGGTTTGTGTAGAGTGG - Intronic
1061377863 9:130236718-130236740 ACAACAGGGAATGTGCAGACTGG - Exonic
1061746222 9:132742347-132742369 AAAACATTTTTTGTAGAGACAGG + Intronic
1186724814 X:12345642-12345664 AACACATGATTTGTGGATACTGG + Intronic
1186752648 X:12637496-12637518 AAGAAATGTTTTGTGGAGACAGG - Intronic
1186814404 X:13222065-13222087 AAAAAATTGTTTGTGGAAACAGG + Intergenic
1187330314 X:18332801-18332823 AAAAAAATTTTTGTGGAGACTGG - Intronic
1188895942 X:35668494-35668516 AAAAGTTGGTTTCTGGAGACAGG - Intergenic
1189197452 X:39164313-39164335 GAAACAGGGTTTGTTGAAACAGG + Intergenic
1189387563 X:40549899-40549921 AAAAAAAGATTTGTAGAGACAGG + Intergenic
1190253277 X:48743597-48743619 AAAAAAATTTTTGTGGAGACAGG - Intergenic
1190706014 X:53028787-53028809 AAAAAAGTTTTTTTGGAGACAGG - Intergenic
1192790607 X:74378819-74378841 AAAACAGATTTTGTGCAGAAAGG + Intergenic
1193128174 X:77891756-77891778 TAAAAATGTTTTGTGGAGACCGG - Intronic
1194016088 X:88623354-88623376 AAAACATGGTTTGTGAAAAGAGG + Intergenic
1195033880 X:100953111-100953133 AAAACATTTTTTGTAGAGACAGG - Intergenic
1195564352 X:106323824-106323846 AAGCCTGGGTTTGTGGGGACTGG - Intergenic
1195800131 X:108699624-108699646 AAAACAGGGAATCTAGAGACAGG - Intergenic
1196238308 X:113308711-113308733 AGTACACGGTTTCTGGAGACAGG + Intergenic
1196384014 X:115128211-115128233 AAAAGAGGGTATGAGGAGGCAGG + Intronic
1196851321 X:119941798-119941820 AAAACACTTTTTGTAGAGACAGG + Intronic
1197252212 X:124228022-124228044 AGAACAGGGAGTGTGGACACAGG + Intronic
1197480298 X:126975754-126975776 TAAATAGGGTTTTTTGAGACAGG + Intergenic
1197814990 X:130488704-130488726 AGAACAGGTTTTGGGGTGACTGG + Intergenic
1198202982 X:134440471-134440493 AAACCATGGTGTGTGGGGACAGG - Intergenic
1199207155 X:145162064-145162086 AAAAAAGGTTTTGTAGAGAGAGG - Intergenic
1199706649 X:150432067-150432089 AAAACAGAGGTTGTGGAGAAAGG - Intronic
1199729781 X:150620612-150620634 AAGACAGAGGTAGTGGAGACTGG - Intronic