ID: 1099653284

View in Genome Browser
Species Human (GRCh38)
Location 12:85456736-85456758
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099653284 Original CRISPR ATGGGGAGCCAGAAAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr