ID: 1099655168

View in Genome Browser
Species Human (GRCh38)
Location 12:85479921-85479943
Sequence CAAAATGCTGGTAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099655168_1099655173 4 Left 1099655168 12:85479921-85479943 CCCATATCACTACCAGCATTTTG No data
Right 1099655173 12:85479948-85479970 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099655168 Original CRISPR CAAAATGCTGGTAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr