ID: 1099658706

View in Genome Browser
Species Human (GRCh38)
Location 12:85527822-85527844
Sequence CCAGTGAGGGCTCTGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658706_1099658714 6 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658706_1099658713 -8 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658713 12:85527837-85527859 CTCACTGGAGCATTGTCTAGTGG No data
1099658706_1099658715 7 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658715 12:85527852-85527874 TCTAGTGGAGCTGTGAGAAAGGG No data
1099658706_1099658716 8 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658706 Original CRISPR CCAGTGAGGGCTCTGTGTGG GGG (reversed) Intergenic