ID: 1099658708

View in Genome Browser
Species Human (GRCh38)
Location 12:85527823-85527845
Sequence TCCAGTGAGGGCTCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658708_1099658715 6 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658715 12:85527852-85527874 TCTAGTGGAGCTGTGAGAAAGGG No data
1099658708_1099658716 7 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658708_1099658713 -9 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658713 12:85527837-85527859 CTCACTGGAGCATTGTCTAGTGG No data
1099658708_1099658714 5 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658708 Original CRISPR TCCAGTGAGGGCTCTGTGTG GGG (reversed) Intergenic