ID: 1099658709

View in Genome Browser
Species Human (GRCh38)
Location 12:85527824-85527846
Sequence CTCCAGTGAGGGCTCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658709_1099658716 6 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658709_1099658713 -10 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658713 12:85527837-85527859 CTCACTGGAGCATTGTCTAGTGG No data
1099658709_1099658715 5 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658715 12:85527852-85527874 TCTAGTGGAGCTGTGAGAAAGGG No data
1099658709_1099658714 4 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658709 Original CRISPR CTCCAGTGAGGGCTCTGTGT GGG (reversed) Intergenic