ID: 1099658710

View in Genome Browser
Species Human (GRCh38)
Location 12:85527825-85527847
Sequence GCTCCAGTGAGGGCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658710_1099658716 5 Left 1099658710 12:85527825-85527847 CCACACAGAGCCCTCACTGGAGC No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658710_1099658714 3 Left 1099658710 12:85527825-85527847 CCACACAGAGCCCTCACTGGAGC No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658710_1099658715 4 Left 1099658710 12:85527825-85527847 CCACACAGAGCCCTCACTGGAGC No data
Right 1099658715 12:85527852-85527874 TCTAGTGGAGCTGTGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658710 Original CRISPR GCTCCAGTGAGGGCTCTGTG TGG (reversed) Intergenic